ID: 1131980746

View in Genome Browser
Species Human (GRCh38)
Location 15:97992290-97992312
Sequence GCTCAAGGTCAGGTGGGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131980746_1131980756 27 Left 1131980746 15:97992290-97992312 CCCAAGCCCACCTGACCTTGAGC No data
Right 1131980756 15:97992340-97992362 TGCCCACTGTTGGCACCACCAGG No data
1131980746_1131980754 -1 Left 1131980746 15:97992290-97992312 CCCAAGCCCACCTGACCTTGAGC No data
Right 1131980754 15:97992312-97992334 CTGCTCATAAACAGAAGGGCTGG No data
1131980746_1131980755 17 Left 1131980746 15:97992290-97992312 CCCAAGCCCACCTGACCTTGAGC No data
Right 1131980755 15:97992330-97992352 GCTGGCTTCATGCCCACTGTTGG No data
1131980746_1131980753 -5 Left 1131980746 15:97992290-97992312 CCCAAGCCCACCTGACCTTGAGC No data
Right 1131980753 15:97992308-97992330 TGAGCTGCTCATAAACAGAAGGG No data
1131980746_1131980752 -6 Left 1131980746 15:97992290-97992312 CCCAAGCCCACCTGACCTTGAGC No data
Right 1131980752 15:97992307-97992329 TTGAGCTGCTCATAAACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131980746 Original CRISPR GCTCAAGGTCAGGTGGGCTT GGG (reversed) Intergenic
No off target data available for this crispr