ID: 1131981039

View in Genome Browser
Species Human (GRCh38)
Location 15:97995039-97995061
Sequence GAACCTCAGCTGGAGACCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131981035_1131981039 4 Left 1131981035 15:97995012-97995034 CCTGAAGTGCAACTGTCCTTCAG No data
Right 1131981039 15:97995039-97995061 GAACCTCAGCTGGAGACCTCAGG No data
1131981034_1131981039 27 Left 1131981034 15:97994989-97995011 CCTTCTCTCATACTGCAGCATGA No data
Right 1131981039 15:97995039-97995061 GAACCTCAGCTGGAGACCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131981039 Original CRISPR GAACCTCAGCTGGAGACCTC AGG Intergenic
No off target data available for this crispr