ID: 1131981694

View in Genome Browser
Species Human (GRCh38)
Location 15:98000515-98000537
Sequence TTGTATTTGAATAAAGATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131981694_1131981697 26 Left 1131981694 15:98000515-98000537 CCATTATCTTTATTCAAATACAA No data
Right 1131981697 15:98000564-98000586 ATAACGACTTTTACGACTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131981694 Original CRISPR TTGTATTTGAATAAAGATAA TGG (reversed) Intergenic
No off target data available for this crispr