ID: 1131981998

View in Genome Browser
Species Human (GRCh38)
Location 15:98003366-98003388
Sequence GCCCTTGACCTTATCATGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 82}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131981998_1131982002 -7 Left 1131981998 15:98003366-98003388 CCCCTCATGATAAGGTCAAGGGC 0: 1
1: 0
2: 0
3: 8
4: 82
Right 1131982002 15:98003382-98003404 CAAGGGCTGTGCAAACGAAAGGG 0: 1
1: 0
2: 0
3: 7
4: 108
1131981998_1131982003 11 Left 1131981998 15:98003366-98003388 CCCCTCATGATAAGGTCAAGGGC 0: 1
1: 0
2: 0
3: 8
4: 82
Right 1131982003 15:98003400-98003422 AAGGGACAGACTTGTTGACAAGG 0: 1
1: 0
2: 0
3: 11
4: 144
1131981998_1131982001 -8 Left 1131981998 15:98003366-98003388 CCCCTCATGATAAGGTCAAGGGC 0: 1
1: 0
2: 0
3: 8
4: 82
Right 1131982001 15:98003381-98003403 TCAAGGGCTGTGCAAACGAAAGG 0: 1
1: 0
2: 0
3: 7
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131981998 Original CRISPR GCCCTTGACCTTATCATGAG GGG (reversed) Intergenic
901512549 1:9724683-9724705 GCCCTTGCCCTGATAATGGGTGG - Intronic
902513799 1:16979607-16979629 ACCCTTGACCTCCTCATGGGAGG + Intronic
904901640 1:33862288-33862310 TTCCTGGATCTTATCATGAGAGG + Intronic
907576130 1:55527579-55527601 GCCCTGGAGCTTATCCTGAGTGG + Intergenic
915707704 1:157862284-157862306 ATCCTTGAACTTATTATGAGAGG - Intronic
916259306 1:162824914-162824936 GACCTTGACCGTATGGTGAGAGG - Intronic
922793504 1:228323974-228323996 GCCCTTGAGCTTCTCCTGAGAGG - Intronic
1063078409 10:2739972-2739994 GCCCTTGAGGAAATCATGAGTGG - Intergenic
1067704568 10:48597319-48597341 GCCCTTTAGCTTTTCATGTGTGG - Intronic
1068015886 10:51515979-51516001 GCCCTTTGCCTTGTCATGTGGGG + Intronic
1068245520 10:54360768-54360790 GCCCTTTAATTGATCATGAGGGG - Intronic
1073045299 10:100634249-100634271 GCCCTTCACCTTGTCCTTAGCGG + Intergenic
1074305028 10:112269109-112269131 GCACTTGAGCTTATCCTGAGTGG - Intergenic
1075257517 10:120937435-120937457 GCCCTTGACCTCAACATTACTGG - Intergenic
1079565481 11:21876908-21876930 ACCCTTGACTTTATTATGAGAGG - Intergenic
1081323928 11:41722806-41722828 GCCCATGACTATATCATGAATGG + Intergenic
1082794535 11:57369774-57369796 GCCCATGACCTAGTCATGAGGGG - Intronic
1082911082 11:58375375-58375397 GCCCTTGAGCTGATCCTGATGGG - Intergenic
1083254768 11:61489366-61489388 ACCCTTGAACTTATGAAGAGGGG - Intronic
1091039632 11:132264853-132264875 GCTCTTGCCCTTTCCATGAGAGG - Intronic
1095296269 12:40530997-40531019 GCCCATGCCCATTTCATGAGAGG + Intronic
1095602194 12:44026473-44026495 GTCCCTGACCTTCTCATCAGTGG + Intronic
1099175534 12:79417634-79417656 GGCCTGGACCTTGTCATGAAAGG - Intronic
1101449333 12:104762076-104762098 GCCGTGGACCTTAGCATGCGGGG + Intergenic
1103183583 12:118936401-118936423 GCCCCTGACCTTGACATGAGGGG - Intergenic
1108361949 13:49676215-49676237 CCCCTTGCCCTCATGATGAGTGG - Intronic
1113198672 13:107839423-107839445 GCTCTATAGCTTATCATGAGAGG + Intronic
1113659973 13:112100209-112100231 CCTCTTGTCCTTATAATGAGTGG + Intergenic
1121981951 14:98462100-98462122 GCCCTTGACCTGATTCTCAGGGG - Intergenic
1125335227 15:38620104-38620126 GCCCATGCCATTATCCTGAGTGG + Intergenic
1125685775 15:41562415-41562437 GCTGTTGACCTAATCATAAGGGG + Intronic
1126570070 15:50141219-50141241 GCCCTTGAGCTTATCTGTAGGGG - Intronic
1126892827 15:53224272-53224294 TCCCTTGCCTTTATCCTGAGAGG + Intergenic
1128426298 15:67544948-67544970 AGCCTGGGCCTTATCATGAGGGG - Intronic
1129150980 15:73687616-73687638 GCCCTGGACTTTATCATGCTGGG + Intronic
1131981998 15:98003366-98003388 GCCCTTGACCTTATCATGAGGGG - Intergenic
1132772958 16:1574747-1574769 GCACTTGACCTTTGCATGGGAGG + Intronic
1133965733 16:10530442-10530464 GCACTTGACCTTCTGCTGAGTGG - Exonic
1135046456 16:19159783-19159805 GACCTTGACCTTAGCATGCTGGG - Intronic
1135929402 16:26724068-26724090 GTCCTTGAGCTTAGCAAGAGGGG + Intergenic
1137856142 16:51796442-51796464 ACCCATGACATTGTCATGAGGGG - Intergenic
1144010447 17:11143398-11143420 GGCTTTGACCCTATCAAGAGTGG + Intergenic
1144052964 17:11513776-11513798 GCCCTGGAGCTGATCCTGAGTGG + Intronic
1152405875 17:80097494-80097516 GGCCGTGACCTGATCAGGAGAGG - Intronic
1168250018 19:55136681-55136703 GTCCTGTAGCTTATCATGAGAGG + Intronic
928176823 2:29039618-29039640 GCCCATGTCCTTTTCATGGGAGG + Intronic
932959470 2:76396061-76396083 ACCCTTGACCTGATCATGTATGG + Intergenic
935925625 2:108065384-108065406 GCCCTTGGCATTCTCTTGAGAGG - Intergenic
937953228 2:127404420-127404442 GCCCTTGACAGTGTCCTGAGAGG + Intergenic
944001411 2:194842870-194842892 GCCCTTTGCCTTTTCATGTGAGG - Intergenic
945785949 2:214237013-214237035 TCCTTAGACCTTATCATGAAAGG + Intronic
947053610 2:226075362-226075384 GCCCCTTGCCTCATCATGAGAGG - Intergenic
948302093 2:236915084-236915106 GGCCTTGACCTGACCATGGGAGG + Intergenic
1170462027 20:16586441-16586463 GACCTTGACCTTCTCATGGCGGG + Intergenic
1177096269 21:16837751-16837773 TCCCTTGACCATCTCATTAGAGG - Intergenic
1182129825 22:27842776-27842798 GCCCTTGACCTAATCTCAAGAGG - Intergenic
964307512 3:155356948-155356970 GCCCTTTGCCTTGTCATGTGGGG + Intergenic
964979099 3:162657000-162657022 GCCCTTGTCATTAGCATAAGAGG + Intergenic
971032334 4:22653242-22653264 GCCCATGACCTTATCATGCTGGG + Intergenic
972300916 4:37784906-37784928 GCCCTTTGCCTTTTCATGTGAGG - Intergenic
973985366 4:56347111-56347133 GCCGTTGAAATAATCATGAGTGG - Intronic
975025902 4:69548950-69548972 GCCCTTTGCCTTGTCATGTGGGG - Intergenic
994645822 5:102467560-102467582 GGCCCTGCCCTTATCATGTGGGG + Intronic
1002925414 6:1603148-1603170 GCACTGTACCTTATCATAAGTGG + Intergenic
1004244780 6:13963899-13963921 GCCCTAGCCCCTATCATGTGTGG - Intronic
1006475495 6:34250020-34250042 GCCCTTGGCCTGATCATTAAGGG + Intergenic
1006764578 6:36493498-36493520 GCCCTTGGCCTTACTGTGAGGGG + Intergenic
1008789862 6:55217182-55217204 GCCCCTGGGCTTTTCATGAGAGG + Intronic
1010070737 6:71741334-71741356 GCCCTCAACCCCATCATGAGGGG + Intergenic
1012694339 6:102358238-102358260 GGCATTGACATTATCATAAGGGG + Intergenic
1013120714 6:107138192-107138214 GCCCTTGATTTTAATATGAGTGG + Intergenic
1013595596 6:111657848-111657870 GCCCGTGAACTGATCATCAGAGG + Intergenic
1016892235 6:149018011-149018033 GCACTTGAGTTTACCATGAGAGG - Intronic
1021132447 7:16927497-16927519 CCCGTTGACCTTATCTTAAGTGG + Intergenic
1021626151 7:22595107-22595129 GGCCTTGACCTTGACATGTGGGG + Intronic
1022958719 7:35404611-35404633 GCCCTTGACCTGTTCATGTGAGG - Intergenic
1024138192 7:46432020-46432042 GCCCTTGACCTTAGTATGCAGGG + Intergenic
1030156435 7:106460350-106460372 GTCCTTGCCCTTATTAAGAGGGG + Intergenic
1030948128 7:115752779-115752801 GCCCTTCTCCATCTCATGAGAGG + Intergenic
1031156019 7:118113421-118113443 GCCATTAACATTAGCATGAGTGG + Intergenic
1031580201 7:123464939-123464961 GAGGTTGACCTTATGATGAGAGG - Exonic
1036295123 8:7528927-7528949 GCCCTGGACTCTGTCATGAGAGG + Intergenic
1036327440 8:7792064-7792086 GCCCTGGACTCTGTCATGAGAGG - Intergenic
1037783401 8:21886690-21886712 CCCATTGTCCTTATAATGAGAGG + Intergenic
1044108783 8:88245629-88245651 GTCCTTGACCTTATCATTTTAGG - Intronic
1044514574 8:93123257-93123279 GACCTTGATCTTTTCATGTGGGG - Intergenic
1052216463 9:25972301-25972323 GCCCTTTGCCTCATCATGTGGGG - Intergenic
1055062261 9:72082075-72082097 CCCCTTCCCCTTATCTTGAGTGG - Intergenic
1186548954 X:10481980-10482002 GGCCTTGACCTTTTCAGGTGAGG + Intronic
1188454831 X:30352253-30352275 GCCCATGCCTATATCATGAGTGG + Intergenic
1188807049 X:34604532-34604554 TCTCTTGACCTTATATTGAGTGG + Intergenic