ID: 1131983247

View in Genome Browser
Species Human (GRCh38)
Location 15:98016560-98016582
Sequence CACTGGAGACCATTAGCCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131983247_1131983256 24 Left 1131983247 15:98016560-98016582 CCCTAGGCTAATGGTCTCCAGTG No data
Right 1131983256 15:98016607-98016629 TACTTGATCTATTGGAAGATCGG No data
1131983247_1131983254 16 Left 1131983247 15:98016560-98016582 CCCTAGGCTAATGGTCTCCAGTG No data
Right 1131983254 15:98016599-98016621 CTCCACGCTACTTGATCTATTGG No data
1131983247_1131983252 -8 Left 1131983247 15:98016560-98016582 CCCTAGGCTAATGGTCTCCAGTG No data
Right 1131983252 15:98016575-98016597 CTCCAGTGGCTGGGTCTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131983247 Original CRISPR CACTGGAGACCATTAGCCTA GGG (reversed) Intergenic
No off target data available for this crispr