ID: 1131993470 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 15:98112528-98112550 |
| Sequence | TTGGATGCAGAGATTGAGCG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1131993470_1131993476 | 6 | Left | 1131993470 | 15:98112528-98112550 | CCACGCTCAATCTCTGCATCCAA | No data | ||
| Right | 1131993476 | 15:98112557-98112579 | TGAGTTGGTGAGGCTTATCCTGG | No data | ||||
| 1131993470_1131993471 | -9 | Left | 1131993470 | 15:98112528-98112550 | CCACGCTCAATCTCTGCATCCAA | No data | ||
| Right | 1131993471 | 15:98112542-98112564 | TGCATCCAACATCCCTGAGTTGG | No data | ||||
| 1131993470_1131993473 | -4 | Left | 1131993470 | 15:98112528-98112550 | CCACGCTCAATCTCTGCATCCAA | No data | ||
| Right | 1131993473 | 15:98112547-98112569 | CCAACATCCCTGAGTTGGTGAGG | No data | ||||
| 1131993470_1131993477 | 7 | Left | 1131993470 | 15:98112528-98112550 | CCACGCTCAATCTCTGCATCCAA | No data | ||
| Right | 1131993477 | 15:98112558-98112580 | GAGTTGGTGAGGCTTATCCTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1131993470 | Original CRISPR | TTGGATGCAGAGATTGAGCG TGG (reversed) | Intergenic | ||