ID: 1131993470

View in Genome Browser
Species Human (GRCh38)
Location 15:98112528-98112550
Sequence TTGGATGCAGAGATTGAGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131993470_1131993476 6 Left 1131993470 15:98112528-98112550 CCACGCTCAATCTCTGCATCCAA No data
Right 1131993476 15:98112557-98112579 TGAGTTGGTGAGGCTTATCCTGG No data
1131993470_1131993471 -9 Left 1131993470 15:98112528-98112550 CCACGCTCAATCTCTGCATCCAA No data
Right 1131993471 15:98112542-98112564 TGCATCCAACATCCCTGAGTTGG No data
1131993470_1131993473 -4 Left 1131993470 15:98112528-98112550 CCACGCTCAATCTCTGCATCCAA No data
Right 1131993473 15:98112547-98112569 CCAACATCCCTGAGTTGGTGAGG No data
1131993470_1131993477 7 Left 1131993470 15:98112528-98112550 CCACGCTCAATCTCTGCATCCAA No data
Right 1131993477 15:98112558-98112580 GAGTTGGTGAGGCTTATCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131993470 Original CRISPR TTGGATGCAGAGATTGAGCG TGG (reversed) Intergenic