ID: 1131999487

View in Genome Browser
Species Human (GRCh38)
Location 15:98164398-98164420
Sequence CTCTCAACACTGGTTGAGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131999487_1131999494 -3 Left 1131999487 15:98164398-98164420 CCGCCCTCAACCAGTGTTGAGAG No data
Right 1131999494 15:98164418-98164440 GAGGAACAGCAGATCCCCAGGGG No data
1131999487_1131999500 27 Left 1131999487 15:98164398-98164420 CCGCCCTCAACCAGTGTTGAGAG No data
Right 1131999500 15:98164448-98164470 CCCACCCACCTATACAGGTGTGG No data
1131999487_1131999493 -4 Left 1131999487 15:98164398-98164420 CCGCCCTCAACCAGTGTTGAGAG No data
Right 1131999493 15:98164417-98164439 AGAGGAACAGCAGATCCCCAGGG No data
1131999487_1131999492 -5 Left 1131999487 15:98164398-98164420 CCGCCCTCAACCAGTGTTGAGAG No data
Right 1131999492 15:98164416-98164438 GAGAGGAACAGCAGATCCCCAGG No data
1131999487_1131999498 22 Left 1131999487 15:98164398-98164420 CCGCCCTCAACCAGTGTTGAGAG No data
Right 1131999498 15:98164443-98164465 TCTTTCCCACCCACCTATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131999487 Original CRISPR CTCTCAACACTGGTTGAGGG CGG (reversed) Intergenic
No off target data available for this crispr