ID: 1132001797

View in Genome Browser
Species Human (GRCh38)
Location 15:98188001-98188023
Sequence ATCCAGCAGGGTGTCCCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132001797_1132001804 5 Left 1132001797 15:98188001-98188023 CCCAAAGGGACACCCTGCTGGAT No data
Right 1132001804 15:98188029-98188051 CCATGGATAAAATGCCATGTGGG No data
1132001797_1132001802 4 Left 1132001797 15:98188001-98188023 CCCAAAGGGACACCCTGCTGGAT No data
Right 1132001802 15:98188028-98188050 GCCATGGATAAAATGCCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132001797 Original CRISPR ATCCAGCAGGGTGTCCCTTT GGG (reversed) Intergenic
No off target data available for this crispr