ID: 1132003408

View in Genome Browser
Species Human (GRCh38)
Location 15:98203084-98203106
Sequence GTATCTTCCTTGTGTAGGTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132003408_1132003411 20 Left 1132003408 15:98203084-98203106 CCGTACCTACACAAGGAAGATAC No data
Right 1132003411 15:98203127-98203149 CTCAGATAAATACCTTGTCAGGG No data
1132003408_1132003410 19 Left 1132003408 15:98203084-98203106 CCGTACCTACACAAGGAAGATAC No data
Right 1132003410 15:98203126-98203148 GCTCAGATAAATACCTTGTCAGG No data
1132003408_1132003412 26 Left 1132003408 15:98203084-98203106 CCGTACCTACACAAGGAAGATAC No data
Right 1132003412 15:98203133-98203155 TAAATACCTTGTCAGGGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132003408 Original CRISPR GTATCTTCCTTGTGTAGGTA CGG (reversed) Intergenic
No off target data available for this crispr