ID: 1132006840

View in Genome Browser
Species Human (GRCh38)
Location 15:98235045-98235067
Sequence GACACTCTGGTGGCTGGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132006834_1132006840 -6 Left 1132006834 15:98235028-98235050 CCTCTTCCGCTCCATGTGACACT No data
Right 1132006840 15:98235045-98235067 GACACTCTGGTGGCTGGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132006840 Original CRISPR GACACTCTGGTGGCTGGACC TGG Intergenic
No off target data available for this crispr