ID: 1132007133

View in Genome Browser
Species Human (GRCh38)
Location 15:98237639-98237661
Sequence GATTACGTATACAAAACGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132007133_1132007138 -8 Left 1132007133 15:98237639-98237661 CCCCCCGTTTTGTATACGTAATC No data
Right 1132007138 15:98237654-98237676 ACGTAATCCAAATTTCCATTTGG No data
1132007133_1132007142 10 Left 1132007133 15:98237639-98237661 CCCCCCGTTTTGTATACGTAATC No data
Right 1132007142 15:98237672-98237694 TTTGGTCAGGCATAGCATAAAGG No data
1132007133_1132007139 -3 Left 1132007133 15:98237639-98237661 CCCCCCGTTTTGTATACGTAATC No data
Right 1132007139 15:98237659-98237681 ATCCAAATTTCCATTTGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132007133 Original CRISPR GATTACGTATACAAAACGGG GGG (reversed) Intergenic
No off target data available for this crispr