ID: 1132008221 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 15:98250043-98250065 |
| Sequence | TCTTTTATTTGGAAAGTGGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1132008221_1132008227 | 10 | Left | 1132008221 | 15:98250043-98250065 | CCTTCCACTTTCCAAATAAAAGA | No data | ||
| Right | 1132008227 | 15:98250076-98250098 | CAAGCTTGCACAAAGAGTAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1132008221 | Original CRISPR | TCTTTTATTTGGAAAGTGGA AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||