ID: 1132008221

View in Genome Browser
Species Human (GRCh38)
Location 15:98250043-98250065
Sequence TCTTTTATTTGGAAAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132008221_1132008227 10 Left 1132008221 15:98250043-98250065 CCTTCCACTTTCCAAATAAAAGA No data
Right 1132008227 15:98250076-98250098 CAAGCTTGCACAAAGAGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132008221 Original CRISPR TCTTTTATTTGGAAAGTGGA AGG (reversed) Intergenic
No off target data available for this crispr