ID: 1132017710

View in Genome Browser
Species Human (GRCh38)
Location 15:98333399-98333421
Sequence ATCACCAGGACTGGGTAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132017704_1132017710 7 Left 1132017704 15:98333369-98333391 CCGCAGCCGCAGCATGTCCATGT No data
Right 1132017710 15:98333399-98333421 ATCACCAGGACTGGGTAATGAGG No data
1132017703_1132017710 11 Left 1132017703 15:98333365-98333387 CCGGCCGCAGCCGCAGCATGTCC No data
Right 1132017710 15:98333399-98333421 ATCACCAGGACTGGGTAATGAGG No data
1132017702_1132017710 16 Left 1132017702 15:98333360-98333382 CCAAGCCGGCCGCAGCCGCAGCA No data
Right 1132017710 15:98333399-98333421 ATCACCAGGACTGGGTAATGAGG No data
1132017700_1132017710 18 Left 1132017700 15:98333358-98333380 CCCCAAGCCGGCCGCAGCCGCAG No data
Right 1132017710 15:98333399-98333421 ATCACCAGGACTGGGTAATGAGG No data
1132017707_1132017710 -10 Left 1132017707 15:98333386-98333408 CCATGTCAAGCTCATCACCAGGA No data
Right 1132017710 15:98333399-98333421 ATCACCAGGACTGGGTAATGAGG No data
1132017705_1132017710 1 Left 1132017705 15:98333375-98333397 CCGCAGCATGTCCATGTCAAGCT No data
Right 1132017710 15:98333399-98333421 ATCACCAGGACTGGGTAATGAGG No data
1132017701_1132017710 17 Left 1132017701 15:98333359-98333381 CCCAAGCCGGCCGCAGCCGCAGC No data
Right 1132017710 15:98333399-98333421 ATCACCAGGACTGGGTAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132017710 Original CRISPR ATCACCAGGACTGGGTAATG AGG Intergenic
No off target data available for this crispr