ID: 1132021724

View in Genome Browser
Species Human (GRCh38)
Location 15:98368337-98368359
Sequence CGGGAAGGAAGTGACTGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132021724_1132021730 -10 Left 1132021724 15:98368337-98368359 CCCACTCAGTCACTTCCTTCCCG No data
Right 1132021730 15:98368350-98368372 TTCCTTCCCGGGAGACGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132021724 Original CRISPR CGGGAAGGAAGTGACTGAGT GGG (reversed) Intergenic
No off target data available for this crispr