ID: 1132024274

View in Genome Browser
Species Human (GRCh38)
Location 15:98391743-98391765
Sequence GCCTGTGGGCCGTTGTTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132024274_1132024281 20 Left 1132024274 15:98391743-98391765 CCAGCAAACAACGGCCCACAGGC No data
Right 1132024281 15:98391786-98391808 TTTTGTAAATAAAGTTTTATTGG 0: 706
1: 1239
2: 1334
3: 1303
4: 2323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132024274 Original CRISPR GCCTGTGGGCCGTTGTTTGC TGG (reversed) Intergenic
No off target data available for this crispr