ID: 1132024569

View in Genome Browser
Species Human (GRCh38)
Location 15:98394087-98394109
Sequence GGGCCATTTCTTTTTAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132024569_1132024575 30 Left 1132024569 15:98394087-98394109 CCTCCTTTAAAAAGAAATGGCCC No data
Right 1132024575 15:98394140-98394162 AACATTTAAACAACCAAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132024569 Original CRISPR GGGCCATTTCTTTTTAAAGG AGG (reversed) Intergenic
No off target data available for this crispr