ID: 1132024575

View in Genome Browser
Species Human (GRCh38)
Location 15:98394140-98394162
Sequence AACATTTAAACAACCAAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132024573_1132024575 1 Left 1132024573 15:98394116-98394138 CCTTCCAAATCACTACGATTTTG No data
Right 1132024575 15:98394140-98394162 AACATTTAAACAACCAAGAATGG No data
1132024569_1132024575 30 Left 1132024569 15:98394087-98394109 CCTCCTTTAAAAAGAAATGGCCC No data
Right 1132024575 15:98394140-98394162 AACATTTAAACAACCAAGAATGG No data
1132024574_1132024575 -3 Left 1132024574 15:98394120-98394142 CCAAATCACTACGATTTTGTAAC No data
Right 1132024575 15:98394140-98394162 AACATTTAAACAACCAAGAATGG No data
1132024571_1132024575 10 Left 1132024571 15:98394107-98394129 CCCAGTACACCTTCCAAATCACT No data
Right 1132024575 15:98394140-98394162 AACATTTAAACAACCAAGAATGG No data
1132024570_1132024575 27 Left 1132024570 15:98394090-98394112 CCTTTAAAAAGAAATGGCCCAGT No data
Right 1132024575 15:98394140-98394162 AACATTTAAACAACCAAGAATGG No data
1132024572_1132024575 9 Left 1132024572 15:98394108-98394130 CCAGTACACCTTCCAAATCACTA No data
Right 1132024575 15:98394140-98394162 AACATTTAAACAACCAAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132024575 Original CRISPR AACATTTAAACAACCAAGAA TGG Intergenic
No off target data available for this crispr