ID: 1132025566

View in Genome Browser
Species Human (GRCh38)
Location 15:98401873-98401895
Sequence CTGTGCTTGGGGAGGTGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132025566_1132025573 14 Left 1132025566 15:98401873-98401895 CCTGGCCACCTCCCCAAGCACAG No data
Right 1132025573 15:98401910-98401932 GCATCCAGACTTCTGTCTTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132025566 Original CRISPR CTGTGCTTGGGGAGGTGGCC AGG (reversed) Intergenic
No off target data available for this crispr