ID: 1132028049

View in Genome Browser
Species Human (GRCh38)
Location 15:98419586-98419608
Sequence ATGGAGGAGGAGGAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132028040_1132028049 5 Left 1132028040 15:98419558-98419580 CCTGAAGGAGGAGAAGGAGGAGG No data
Right 1132028049 15:98419586-98419608 ATGGAGGAGGAGGAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132028049 Original CRISPR ATGGAGGAGGAGGAGGAGGA GGG Intergenic
No off target data available for this crispr