ID: 1132032048

View in Genome Browser
Species Human (GRCh38)
Location 15:98446296-98446318
Sequence GAGGTGGACCTGTCCATGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 137}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132032048_1132032053 -4 Left 1132032048 15:98446296-98446318 CCTACCATGGACAGGTCCACCTC 0: 1
1: 0
2: 1
3: 13
4: 137
Right 1132032053 15:98446315-98446337 CCTCCCGGCTTCTCCTGATGAGG 0: 1
1: 0
2: 2
3: 16
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132032048 Original CRISPR GAGGTGGACCTGTCCATGGT AGG (reversed) Intronic
900123959 1:1061416-1061438 GAGAGGGACCTGGCCAGGGTGGG + Intergenic
902391944 1:16112112-16112134 GACGTGGCCCTGCCCACGGTTGG + Intergenic
903215970 1:21843430-21843452 GCCGTGGACCTGGCCAAGGTGGG + Exonic
906769378 1:48471133-48471155 GGGCTGGACCTCTCCATGCTAGG - Intronic
908750231 1:67415196-67415218 GAGGTGGACGTGGGCGTGGTGGG - Exonic
910697851 1:90040472-90040494 GAGGTTGTCCTGTGCATTGTAGG + Intergenic
913274013 1:117120882-117120904 CAGGTGGACCTGCCCATGGGTGG - Exonic
918152739 1:181812354-181812376 GAGGTCGAACTCTCCATGGGTGG + Intergenic
921434753 1:215105474-215105496 GAGGTGGAAATGTCCATCGATGG - Intronic
1063118315 10:3086567-3086589 GGTGTGGTCCTGTCCATCGTAGG - Intronic
1065175316 10:23069849-23069871 GAGGAAGAACTGGCCATGGTTGG + Intergenic
1066212629 10:33254896-33254918 TAGGTGGACATGTCCCTGGAGGG + Intronic
1067211910 10:44266511-44266533 CAGGTGGAACAGGCCATGGTGGG - Intergenic
1067339352 10:45388459-45388481 GAGGTGTACCTGGCCATGTGGGG - Intronic
1069875876 10:71562569-71562591 GAGGAGGCCCTGCCCATGGCTGG + Intronic
1072783841 10:98267622-98267644 GAGCTGTACCTGTCCAGGCTAGG + Intronic
1074470479 10:113722144-113722166 GAGATGGGCCTGGCCATGGTGGG - Intronic
1076572801 10:131443715-131443737 GAAGAGGAACTGTCCATGGCAGG - Intergenic
1076785080 10:132745655-132745677 GTGGTGGCCCTGGGCATGGTGGG + Intronic
1077025894 11:439710-439732 AAGGTGGGCCTCTCCATGCTTGG - Intronic
1077484324 11:2831923-2831945 GAGCTGGACATGCCCCTGGTAGG + Intronic
1078533730 11:12156702-12156724 CAGGTGTTCCTGCCCATGGTGGG + Intronic
1083011978 11:59410447-59410469 GAGGTGAAACTGTTCATGCTTGG - Intergenic
1083380256 11:62261711-62261733 GAGGTGGCCCAGACCCTGGTTGG + Intergenic
1083598510 11:63931902-63931924 TAGGTGGACCTGGCCTTGGGTGG + Intergenic
1084314578 11:68337700-68337722 GAGGTAGACCTGACTATGGGTGG - Intronic
1089857769 11:121561743-121561765 GACCTGGACCTGTGCATGGGCGG + Intronic
1093096093 12:14973767-14973789 CAGGTAGACCAGTCCATTGTTGG - Intronic
1094439962 12:30463955-30463977 GAGGTGGTCAAGTCCATGATAGG - Intergenic
1096182672 12:49559243-49559265 GATGTGGACCTGTCTCTGGAGGG - Exonic
1099390964 12:82078183-82078205 AAGGTGAACCTGCCCTTGGTTGG - Intergenic
1100555557 12:95689725-95689747 AAGGTGGACCTGTCCCTTGTGGG - Intronic
1100811136 12:98339495-98339517 GAGGTGGAGGTGTGCAGGGTTGG - Intergenic
1102761584 12:115390743-115390765 CAGGTGGTCCTCTCCCTGGTGGG - Intergenic
1103415480 12:120739609-120739631 GAGGCGGAGCTGCCAATGGTCGG - Exonic
1103956990 12:124582800-124582822 CAAGTGGGCCTGTCCGTGGTTGG - Intergenic
1104802895 12:131566761-131566783 GATGTGGATCTGTCCTGGGTTGG - Intergenic
1108482420 13:50887677-50887699 GGGCTGGACCTGTGCTTGGTGGG + Intergenic
1111242704 13:85496588-85496610 GTGGGGGACCTCTCCATTGTTGG - Intergenic
1113890095 13:113731169-113731191 GAGGTGGTCACCTCCATGGTGGG - Intronic
1113962575 13:114133472-114133494 GGGGGGGACCTGCCCATGCTGGG - Intergenic
1113962713 13:114133788-114133810 GGGGGGGACCTGCCCATGCTGGG - Intergenic
1114241403 14:20871710-20871732 GAGGTGGACCTGGCCAGGCACGG + Intergenic
1114369536 14:22070744-22070766 GAGTTGGGGCTGTCCAAGGTGGG + Intergenic
1118287007 14:64484328-64484350 GAGGTAGAGTTGTACATGGTTGG - Exonic
1121944357 14:98104870-98104892 GAGAGGGACTTCTCCATGGTTGG - Intergenic
1122017157 14:98805785-98805807 GAGGTGGAGCTGTGTTTGGTGGG + Intergenic
1202853748 14_GL000225v1_random:37334-37356 GAGGTGGAGCTGTCCCGGATTGG - Intergenic
1202859405 14_GL000225v1_random:72233-72255 GAGGTGGAGCTGCCCCAGGTTGG + Intergenic
1128766916 15:70256846-70256868 GAGGTTTCCCTGTCCATCGTGGG + Intergenic
1129709367 15:77812677-77812699 GAGGTGAGCCTGGCCATTGTTGG - Intronic
1131467530 15:92667701-92667723 GAGGTGGAAATGTCCAAAGTGGG - Intronic
1132032048 15:98446296-98446318 GAGGTGGACCTGTCCATGGTAGG - Intronic
1134777192 16:16863441-16863463 GGGGTGGCCCTGTGCATTGTAGG - Intergenic
1136239896 16:28937346-28937368 GAGCTGGTCCTGCCCAAGGTTGG - Exonic
1138445035 16:57058335-57058357 GTGGAGGATCTGCCCATGGTGGG - Intronic
1138587536 16:57980452-57980474 GGGCAGGACCAGTCCATGGTTGG + Intronic
1141787558 16:86211966-86211988 GAGGTGGGCCTTTCCCTGGTAGG - Intergenic
1143946055 17:10593459-10593481 GAGGTGGACCTGTGCGTTGTAGG + Intergenic
1145273281 17:21415826-21415848 GTGGTGGCCCAGTCCATCGTGGG + Exonic
1145311470 17:21703270-21703292 GTGGTGGCCCAGTCCATCGTGGG + Exonic
1146915156 17:36673609-36673631 GAGGTGGACTTGACCCTGGGAGG + Intergenic
1148856173 17:50580373-50580395 GAGGGGCACCTGACCATGGCCGG - Intronic
1149017440 17:51924712-51924734 CAGGTGTTCCTCTCCATGGTTGG + Intronic
1151455198 17:74221776-74221798 GAGGTTCAGCTGTCCCTGGTGGG + Intronic
1151701313 17:75743989-75744011 CAGGTGGACGTGTCCTTGGGAGG - Intronic
1152003770 17:77664158-77664180 GAGGTGGGCCTGTCCCTGGAGGG + Intergenic
1152541831 17:80980430-80980452 GAGCAGGGCCTGCCCATGGTAGG + Intergenic
1155729533 18:29136103-29136125 GAAGTGAATCTGCCCATGGTAGG + Intergenic
1159391874 18:67803993-67804015 GATGTGGACCAGTCCATAGTGGG + Intergenic
1161331799 19:3692095-3692117 GAGCCGGCCCTGCCCATGGTGGG - Intronic
1162693709 19:12454905-12454927 GAGGTGGTCCTATCCAATGTAGG - Intronic
1163600703 19:18247635-18247657 GGGGTGGCCCAGGCCATGGTGGG - Intronic
926104664 2:10142657-10142679 GTGGGGGATCTGGCCATGGTGGG - Intronic
929532486 2:42761742-42761764 GAGGTGGCCCCGCCCAGGGTTGG + Intergenic
931714830 2:65020904-65020926 GTGGTGGTCCGGTCCCTGGTGGG - Exonic
935118208 2:100157033-100157055 GAGGAGTACCTGGCCATGGGAGG + Intergenic
935552750 2:104475723-104475745 GAGCTGGAATGGTCCATGGTAGG - Intergenic
940135029 2:150425912-150425934 GAGGTGGACTTGTCTATATTAGG + Intergenic
941592380 2:167436300-167436322 GAGGTGGAACTCTTCATGGCAGG - Intergenic
944398949 2:199303567-199303589 GGGGTTGCCCTGTGCATGGTGGG + Intronic
947730382 2:232425657-232425679 GTGATGGACCAGTCCATGGAAGG + Intergenic
947831502 2:233144718-233144740 GAGGTGGGCATGATCATGGTGGG + Intronic
948269408 2:236662795-236662817 GAGGTGGTCCTGTGCACTGTAGG - Intergenic
1169139955 20:3222082-3222104 TGGGTGGCCCAGTCCATGGTTGG + Intronic
1171444469 20:25194297-25194319 GAGGTGGAATTGGCTATGGTGGG - Intergenic
1173458092 20:43219821-43219843 GAGGGGGACCTATCCACGGAGGG + Intergenic
1174390550 20:50216144-50216166 GGGGTGGCCCGGTCCAGGGTGGG + Intergenic
1176286981 21:5023506-5023528 TAGGCGGCCCTGTCCATGCTGGG + Intronic
1179870200 21:44239969-44239991 TAGGCGGCCCTGTCCATGCTGGG - Intronic
1181734506 22:24871095-24871117 GAGGTGGTCCTGTGCATTGTGGG + Intronic
1183086541 22:35490558-35490580 GAGATGGACTTTTCCAGGGTTGG + Intergenic
1183343445 22:37294485-37294507 GGAGGGGACCTGTCCATGGAGGG + Intronic
1183540665 22:38427654-38427676 GTGGTGGTCCAGTCCATCGTGGG - Exonic
1183617869 22:38956087-38956109 GAGGAGGACGTGCCCAGGGTGGG + Intronic
1184021327 22:41823695-41823717 GAGGGCGTCCTGTCCAGGGTTGG - Intronic
1184987208 22:48144056-48144078 GTGGTGGACCTGTTCTTGCTGGG + Intergenic
950958531 3:17080297-17080319 GAAGTGGACCTGACCAAGCTAGG + Intronic
953846418 3:46430550-46430572 GGGGGGACCCTGTCCATGGTTGG - Intergenic
955521932 3:59783646-59783668 GAGGTGGTCCTGTGCATTGTAGG + Intronic
956891648 3:73620050-73620072 GAGGCTGACCTGTGCATTGTAGG - Intronic
960143632 3:114175058-114175080 GAGGTTGTCCTGTGCATTGTGGG + Intronic
962887389 3:139640061-139640083 GAGGTGGGACAGTGCATGGTGGG + Intronic
966660685 3:182411231-182411253 GAGCTGGGCCTGTCCAGAGTTGG + Intergenic
975248667 4:72150681-72150703 GATGAGGGCCAGTCCATGGTGGG - Intergenic
975849182 4:78553901-78553923 GAGGTGGTCCAGTCCTTGGTGGG - Intronic
977311632 4:95395082-95395104 ATGGTGGAGCTCTCCATGGTGGG + Intronic
977414118 4:96709351-96709373 GAGGCTGTCCTGTGCATGGTAGG + Intergenic
978835047 4:113139189-113139211 GAGGTGTGACTGTTCATGGTAGG - Intronic
984701598 4:182822087-182822109 GTGGTTGACATGTCCATTGTTGG - Intergenic
997579011 5:135005540-135005562 GAGCTGGACCTGCCCATGGTCGG + Intronic
1002463632 5:179389885-179389907 CACTTGGACCTCTCCATGGTAGG - Intergenic
1003404939 6:5820548-5820570 GAGGTGGAGGGGTCCTTGGTGGG + Intergenic
1003917947 6:10805105-10805127 GAGGCTGTCCCGTCCATGGTTGG + Intronic
1004025436 6:11813744-11813766 GAGATGGATGTGTCCCTGGTGGG - Intergenic
1006932284 6:37695662-37695684 GAGGTTGACCTGTTCTTTGTGGG - Intronic
1016479342 6:144465055-144465077 GAGGCTGTCCTGTACATGGTGGG - Intronic
1016737260 6:147492794-147492816 GAGGAGGACCTGGCCTTGGGTGG - Intergenic
1017225065 6:152011671-152011693 AAGGTGGACCTGATCATGGAGGG - Exonic
1018372562 6:163181512-163181534 GGGGTGGACTTGTCCTTGGAAGG - Intronic
1023864675 7:44233102-44233124 GAGGTGCTGCTGTCCAGGGTGGG + Intronic
1023940263 7:44764966-44764988 GAGGTGGACCAGTACATGCTGGG + Exonic
1025603916 7:63025125-63025147 GGGGTCGTCCTGTGCATGGTAGG + Intergenic
1027436281 7:78167944-78167966 GAGGTTGACCTGCCCATTGCGGG + Exonic
1029702201 7:102254538-102254560 GAGGTGGGTCTGTCCACTGTGGG + Exonic
1031535931 7:122932619-122932641 GAAGGGGCCCTGGCCATGGTGGG - Intergenic
1034425289 7:151010754-151010776 GAGGTGGATCTCTCCTGGGTGGG - Exonic
1034460264 7:151194152-151194174 GAGGTGGACATGTCCAGCCTGGG - Intronic
1035596793 8:864730-864752 CAGGTGCACCTGTCGATGGGAGG + Intergenic
1036568942 8:9962685-9962707 GAGGCTGCCCTGTGCATGGTAGG - Intergenic
1037594312 8:20341999-20342021 GAGGTGGAGTAGTCCATTGTAGG + Intergenic
1039381132 8:37086418-37086440 CAGGTAGACCTGTACATGGGAGG - Intergenic
1042097436 8:65232774-65232796 GAGGGCATCCTGTCCATGGTAGG + Intergenic
1042786899 8:72557791-72557813 GAGGTAGCACTGTCCATTGTTGG + Intronic
1043163898 8:76879563-76879585 GAGGTGGTCCTTTGCCTGGTAGG + Intergenic
1049094813 8:140542173-140542195 GAGGTGGCCCAGCCCATGGAGGG + Intronic
1049656621 8:143801825-143801847 GAGGTGGCTCTGTCCGTGGCTGG + Intronic
1050635536 9:7608346-7608368 GAGGTGGCCCAGAACATGGTTGG + Intergenic
1056826714 9:89880961-89880983 GAGCTGGACATGTCCATTGAGGG - Intergenic
1058849626 9:108998261-108998283 GAGGTTGACCTGTACATTGTAGG - Intronic
1059593654 9:115692601-115692623 GAGGCTGTCCTGTCCATTGTAGG - Intergenic
1060221369 9:121765764-121765786 CAGGTGGGCCTGACCATGGCAGG + Intronic
1060411383 9:123402760-123402782 GAAGTGGACCTGCCTGTGGTGGG - Intronic
1061012902 9:127965898-127965920 GAGGAGGTCCTGGCCATGCTAGG - Intronic
1061716711 9:132522817-132522839 GGTGTGGACCTGTGCATGGTAGG + Intronic
1062104513 9:134746210-134746232 GAGCTGGGCCTGCCCAGGGTCGG + Intronic
1062332200 9:136049737-136049759 GAGGTGGGGCTGTCGGTGGTGGG + Exonic
1062459932 9:136658807-136658829 GGGGTGGACCGGACCAGGGTAGG + Intergenic
1187399470 X:18946880-18946902 GAGGGGGGCCTGTGCATTGTAGG + Intronic
1187848442 X:23566030-23566052 GAGGGGTACCTGGCCATGGGAGG + Intergenic
1190433586 X:50401923-50401945 GAGGCTGACCTGTGCATTGTAGG + Intronic
1197806133 X:130400294-130400316 GAGGAGGAACTGTCATTGGTGGG + Intergenic