ID: 1132032448

View in Genome Browser
Species Human (GRCh38)
Location 15:98450060-98450082
Sequence CAAGCGAGCTGGCCCCCAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 113}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132032445_1132032448 -6 Left 1132032445 15:98450043-98450065 CCAGAATGTGGCAATACCAAGCG 0: 1
1: 0
2: 0
3: 4
4: 65
Right 1132032448 15:98450060-98450082 CAAGCGAGCTGGCCCCCAGCCGG 0: 1
1: 0
2: 1
3: 7
4: 113
1132032443_1132032448 9 Left 1132032443 15:98450028-98450050 CCTTGGAGTGTTGCACCAGAATG 0: 1
1: 0
2: 0
3: 17
4: 142
Right 1132032448 15:98450060-98450082 CAAGCGAGCTGGCCCCCAGCCGG 0: 1
1: 0
2: 1
3: 7
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132032448 Original CRISPR CAAGCGAGCTGGCCCCCAGC CGG Intronic
901054720 1:6443816-6443838 CAAGCGGGCTTGCCGGCAGCAGG + Intronic
901422775 1:9162236-9162258 CATGTGACCTGCCCCCCAGCCGG + Intergenic
902216456 1:14937305-14937327 AAAGGGAGCTGGCCCCAAGTAGG - Intronic
902479640 1:16704788-16704810 CAAGCGGGCTTGCCGGCAGCAGG - Intergenic
903368060 1:22816977-22816999 CAGGCAGGCTGGCTCCCAGCTGG + Intronic
903653588 1:24935400-24935422 CAAGGGAGCTGGCGCCCCGCGGG - Intronic
905476497 1:38232385-38232407 CCTGCTAGCTCGCCCCCAGCTGG - Intergenic
905915762 1:41683224-41683246 TAAGCCAACTGGACCCCAGCTGG + Intronic
918387318 1:184022931-184022953 CAAGGCAGCTGGCCTACAGCTGG + Intronic
920542981 1:206793327-206793349 CACGTGAGCTGGGCCCCAGGAGG + Intergenic
1067825839 10:49572301-49572323 CTTGCGAGCCAGCCCCCAGCTGG + Intergenic
1068811974 10:61266300-61266322 CAAGCCAGCTGAATCCCAGCAGG - Intergenic
1072560466 10:96568908-96568930 CAAGCGTGCTGGCTCACACCTGG + Intronic
1074424542 10:113339252-113339274 CAAGGCAGCTGGGCCCCATCTGG - Intergenic
1077488089 11:2848239-2848261 CAAGCGCCCTGGCCCCCACATGG + Exonic
1080871033 11:36237182-36237204 CAAAAGAGCAGGCCCCCAGGTGG - Intergenic
1082006580 11:47422689-47422711 AAAGCTGGCTGGCCCCCAGCTGG - Exonic
1083966240 11:66045568-66045590 GATGGGATCTGGCCCCCAGCAGG + Intronic
1091327961 11:134706046-134706068 CAAGGGGGCTGCCTCCCAGCGGG + Intergenic
1092074204 12:5659691-5659713 CAAGTGAGCTGGACCCCAGGAGG - Intronic
1093970291 12:25369812-25369834 GAAGCCAGCTGGGCTCCAGCTGG + Intergenic
1093973038 12:25391875-25391897 GAAGCCAGCTGGGCTCCAGCTGG + Intergenic
1096038423 12:48493022-48493044 CAAGGGAGATGGCACCCACCTGG + Intronic
1096562225 12:52444418-52444440 CAAGCCAGCTGGCATCTAGCTGG + Intergenic
1097143754 12:56925486-56925508 CAAGGGTCCTGGCCCCAAGCGGG - Intronic
1099689646 12:85936880-85936902 CAACCCAGCTGGCTCCCAGCTGG + Intergenic
1100707111 12:97212905-97212927 CAAACCAGCTGACCCCCAGTGGG - Intergenic
1108446335 13:50512487-50512509 AAACCAAGCTGGCCCGCAGCAGG - Intronic
1113785278 13:112999158-112999180 CAGGCGGTCTGGCCCCAAGCCGG - Intronic
1113911574 13:113843761-113843783 CAGACAAGCAGGCCCCCAGCGGG - Intronic
1117253416 14:53956002-53956024 CACCCAATCTGGCCCCCAGCTGG - Intronic
1117582537 14:57166954-57166976 CAAGCAAGAAGGCCCCCATCTGG + Intergenic
1121129141 14:91429294-91429316 ATAGCCAGCTGGCCTCCAGCAGG + Intergenic
1121640457 14:95481654-95481676 CAGGAGAGCTGACCCCCTGCGGG - Intergenic
1122706570 14:103625630-103625652 CAAGTGAGCTGACGGCCAGCAGG - Intronic
1122887086 14:104714892-104714914 CCAGGGCGCTGGCACCCAGCCGG + Intronic
1123066883 14:105623392-105623414 ATAGCGACCTGGCCCTCAGCAGG + Intergenic
1123070903 14:105642103-105642125 ATAGCGACCTGGCCCTCAGCAGG + Intergenic
1123075866 14:105667160-105667182 ATAGCGACCTGGCCCTCAGCAGG + Intergenic
1123090567 14:105740387-105740409 ATAGCGACCTGGCCCTCAGCAGG + Intergenic
1123096197 14:105768137-105768159 ATAGCGACCTGGCCCTCAGCAGG + Intergenic
1128495767 15:68197680-68197702 GAAGCCAGCTGGCCTCCTGCTGG + Intronic
1129109539 15:73329492-73329514 CCAGCCAGTGGGCCCCCAGCAGG - Intronic
1129386963 15:75201741-75201763 CTAGCGAGCTGGCCCCACGCGGG + Intronic
1129414583 15:75368245-75368267 CCGGCCAGCTGGCCCCCAGGCGG - Intronic
1132032448 15:98450060-98450082 CAAGCGAGCTGGCCCCCAGCCGG + Intronic
1132831339 16:1929854-1929876 CGAGCGAGCGTGCCCCCTGCTGG + Intergenic
1133784543 16:8963952-8963974 CAAGCGGGCGGGCGCCGAGCCGG + Intronic
1138348393 16:56333731-56333753 CCAGCAAGCTGGCCCCCAGCAGG + Intronic
1139486314 16:67258521-67258543 CAAGCAGGCTGGCCCTGAGCAGG + Intronic
1140474949 16:75235146-75235168 CCCGCGAGCAGGCCACCAGCCGG + Exonic
1142031052 16:87838832-87838854 CCAGTGAGCTGGGCCCCACCGGG + Intronic
1142131279 16:88432648-88432670 CAAGCAGCCTGGCCCACAGCTGG + Exonic
1142866489 17:2794571-2794593 CAAGGCAGCTAGTCCCCAGCAGG - Intronic
1145034925 17:19534169-19534191 CGAGCGAGCTGTCCGCCGGCGGG + Intronic
1145976423 17:28986643-28986665 CAAGCCAGCTGGCCCTGAGGTGG - Intronic
1146642121 17:34549369-34549391 CCAGGGAGGTGGCCCCAAGCAGG + Intergenic
1150514204 17:65790505-65790527 GAAGCCAGCTGGGCCCAAGCTGG - Intronic
1157556531 18:48616339-48616361 CCGGAGAGCTGGCCCCAAGCAGG - Intronic
1157663311 18:49464705-49464727 CATGCGAGCTGTCCACCATCTGG - Intergenic
1163470938 19:17496601-17496623 CAGGAGAGCTGGCACCCCGCAGG - Intronic
1168011642 19:53538101-53538123 CATGCGCGCTGGCCTCCAGGGGG + Intronic
1202713676 1_KI270714v1_random:30694-30716 CAAGCGGGCTTGCCGGCAGCAGG - Intergenic
925888289 2:8412132-8412154 CAGGCTAGCTGGCTCCCTGCTGG + Intergenic
928365418 2:30696857-30696879 CAACCCAGCTGTCCCTCAGCTGG - Intergenic
929922482 2:46182435-46182457 CAGGAGGGCTGGCCCCCGGCAGG - Intronic
931200392 2:60092189-60092211 CAGGCTTGCTGGGCCCCAGCTGG + Intergenic
935343620 2:102082713-102082735 CAAGCGAGCATGCCATCAGCAGG + Intronic
937241672 2:120466068-120466090 CAGGCGACCTGCCCACCAGCCGG + Intergenic
938369710 2:130761584-130761606 GAAGGCAGCTGGCCCTCAGCTGG - Intronic
938954320 2:136284117-136284139 AAAGCCAGCTGCCCCCTAGCAGG - Intergenic
945251247 2:207768171-207768193 CACACGAACGGGCCCCCAGCGGG + Exonic
1169117164 20:3072996-3073018 CCAAGGAGCTGGCCCCCAGGAGG + Intergenic
1170330551 20:15205981-15206003 CAAGGAAGCAGTCCCCCAGCAGG + Intronic
1172837674 20:37883452-37883474 CAATCTCGCTGGGCCCCAGCTGG - Intergenic
1173283172 20:41647561-41647583 CAAGCTAGCTGTAACCCAGCTGG - Intergenic
1175856981 20:62126384-62126406 GCAGGGAGCTGGCCGCCAGCGGG - Exonic
1179489152 21:41728840-41728862 CAAGGGAGTTGGCCACCAACAGG - Intergenic
1179610676 21:42548026-42548048 GAAGAGAGCTGACCCCCAGAGGG - Intronic
1183495298 22:38139929-38139951 CAGGAGAGCTGGAGCCCAGCAGG + Intronic
1184217515 22:43077472-43077494 CCAGCTCCCTGGCCCCCAGCAGG - Intronic
951574655 3:24101370-24101392 CAACTGTGCTGGCCTCCAGCTGG + Intergenic
953338664 3:42115758-42115780 CAAGTGAGCTGTCCCTCAGTGGG + Intronic
954287095 3:49626761-49626783 CAAGGGAGCTGGAACCCAGAGGG - Intronic
955486411 3:59438929-59438951 CATGCCACCTGGCACCCAGCAGG - Intergenic
957827637 3:85469343-85469365 CAAGGGAGCTGGAGCCAAGCAGG + Intronic
967267305 3:187701997-187702019 CCAGTGAGCTGGCCCCTGGCTGG - Exonic
968427183 4:531882-531904 CAAGCCAGGTGGCCTCCGGCAGG + Intronic
968623727 4:1616385-1616407 CAAGCAAGTTGGCGCCCAGCAGG + Intergenic
968733302 4:2281908-2281930 GAAGTGAGCTGGTGCCCAGCGGG + Intronic
970315914 4:14828155-14828177 CAGGGGAGCTGGCCAGCAGCGGG - Intergenic
970934598 4:21554287-21554309 CAAGTGAGCAGGCCAGCAGCAGG + Intronic
976921713 4:90451142-90451164 CAAGGCAGCTGTCACCCAGCGGG - Intronic
983678413 4:170323196-170323218 CAAGAAAGCAGGCACCCAGCTGG - Intergenic
983989595 4:174101499-174101521 CAAGCTAGCTGGCTCCCATTTGG + Intergenic
985205992 4:187537563-187537585 CAAGCAAGATGCCCCTCAGCAGG - Intergenic
985776848 5:1848796-1848818 CAACCAAGCTGGCCAACAGCTGG - Intergenic
990667157 5:58086000-58086022 GAAGCCAGCTGGCCCACAGTTGG - Intergenic
999654084 5:153795683-153795705 TTAGAGAGCTGGGCCCCAGCAGG + Intronic
1006363687 6:33602005-33602027 CAAGCAAGCTGCCCGGCAGCAGG - Intergenic
1007266431 6:40599762-40599784 GAAGCGCGCTGGCCTTCAGCTGG - Intergenic
1007633206 6:43283980-43284002 CAAGCGGGCTCGGCCGCAGCAGG + Exonic
1015523375 6:134153017-134153039 CAATCAACCTGGCCCCCACCAGG + Intergenic
1017042324 6:150317483-150317505 CAAGGGAGGTGGCCCACATCAGG - Intergenic
1017862232 6:158409539-158409561 GAACCCAGCTGGCCCCCAGCTGG + Intronic
1019408997 7:898531-898553 CCACCGTGCTGGCCCCAAGCAGG + Exonic
1019922898 7:4174159-4174181 CAACCCAGCTGGCCTGCAGCAGG - Intronic
1027219073 7:76202449-76202471 GAAGGGAGCAGGCCCCCACCTGG + Intronic
1029567813 7:101350596-101350618 CAAGCCCGCTGGTGCCCAGCAGG - Intergenic
1039546959 8:38417309-38417331 CCTGCGTGCAGGCCCCCAGCAGG + Exonic
1048969651 8:139638358-139638380 CAAAGGATCTGGCACCCAGCAGG + Intronic
1049164462 8:141117651-141117673 AAAGCCAGCGGGCCCCCAGGTGG - Intronic
1050533477 9:6610141-6610163 CAGGCGAGGTGGCCCACAACTGG + Intronic
1051618289 9:19027580-19027602 AAAGCTGACTGGCCCCCAGCTGG + Intronic
1062379141 9:136278412-136278434 AAAGCGAGCCGTCCCCGAGCTGG + Intergenic
1062583265 9:137237518-137237540 GAAGAGAGCTGCCCCCCAACAGG - Intergenic
1185857795 X:3552008-3552030 CAGGGGAGCTGGCTCCCAGAAGG + Intergenic
1186177511 X:6940657-6940679 CAAGGAAGATGGCTCCCAGCAGG - Intergenic
1195861153 X:109384754-109384776 GAAGCCAGCTGCCTCCCAGCTGG - Intronic
1196964593 X:121042161-121042183 AATGTGTGCTGGCCCCCAGCAGG + Intergenic
1199092263 X:143705724-143705746 CAAGCGTGCTCTCACCCAGCTGG - Intergenic
1202600349 Y:26587842-26587864 CAAACCAGCAGGCCTCCAGCTGG + Intergenic