ID: 1132035795

View in Genome Browser
Species Human (GRCh38)
Location 15:98483112-98483134
Sequence AATGCTATGAAGAATGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1448
Summary {0: 1, 1: 0, 2: 3, 3: 97, 4: 1347}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132035795_1132035797 0 Left 1132035795 15:98483112-98483134 CCATCCACATTCTTCATAGCATT 0: 1
1: 0
2: 3
3: 97
4: 1347
Right 1132035797 15:98483135-98483157 CAGAACAGTCAGTCATTAAGTGG 0: 1
1: 0
2: 0
3: 11
4: 146
1132035795_1132035798 8 Left 1132035795 15:98483112-98483134 CCATCCACATTCTTCATAGCATT 0: 1
1: 0
2: 3
3: 97
4: 1347
Right 1132035798 15:98483143-98483165 TCAGTCATTAAGTGGCCACCTGG 0: 1
1: 0
2: 0
3: 15
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132035795 Original CRISPR AATGCTATGAAGAATGTGGA TGG (reversed) Intronic
900748651 1:4379157-4379179 AATGCTGTAAAGATTGGGGATGG - Intergenic
900775198 1:4578343-4578365 AATTCTGTGAAGAATGTCAATGG + Intergenic
902175274 1:14645326-14645348 AGTTCTATGAAGAATGTTGGTGG + Intronic
902357809 1:15919001-15919023 AAAGCTATTAAGAAGATGGATGG + Exonic
902602119 1:17547113-17547135 TATGCTATGGAAAATGGGGAAGG + Intronic
903192171 1:21662979-21663001 AATTCTAGGAAGATTCTGGATGG - Intronic
904068856 1:27777151-27777173 AATGCTATGAAGAAAAAGCAGGG + Intronic
905019784 1:34801071-34801093 AAGGCTCTGAAGAAGGAGGAAGG + Intronic
905953086 1:41969175-41969197 AATTCTAAGAAGAATGTCAATGG - Intronic
905962411 1:42054799-42054821 AATTCTATGAAGAATGTCAATGG + Intergenic
906051104 1:42873446-42873468 AATTCTATGAAGAATGTCATTGG + Intergenic
906109004 1:43311243-43311265 CATGCTATGAAGCGTGTGGCGGG + Intronic
906736501 1:48134385-48134407 AATTCTGTGAAGAATGTCAATGG + Intergenic
906890243 1:49704951-49704973 AATTCTGTGAAGAATGTCAATGG + Intronic
908091362 1:60688771-60688793 AATTCTGTGAAGAATGTCAATGG - Intergenic
908106175 1:60844641-60844663 AATTCTGTGAAGAATGTCAATGG - Intergenic
908305652 1:62813087-62813109 AATTCTGTGAAGAAAGTGAATGG - Intronic
908451130 1:64256235-64256257 AATTCTGTGAAGAATGTCAATGG - Intronic
908614112 1:65898431-65898453 AATGCTGTGAAGAATGATGGTGG - Intronic
908866284 1:68552343-68552365 AATTCTGTGAAGAATATTGATGG - Intergenic
908879368 1:68713248-68713270 AATTCTGTGAAGAATGTCAATGG - Intergenic
908879878 1:68719230-68719252 AATTCTGTGAAGAATGTCAATGG - Intergenic
908943440 1:69464835-69464857 AATTCTTTGAAGAATGTCAATGG + Intergenic
908950768 1:69560277-69560299 AATTATATGAAGAATGTCAATGG - Intergenic
909037783 1:70614072-70614094 AATTCTGTGAAGAATGTCAATGG - Intergenic
909136955 1:71813458-71813480 AATTCTGTGAAGAATGTCAATGG + Intronic
909211914 1:72834904-72834926 AATTCTGTGAAGAATGTCAAGGG - Intergenic
909230331 1:73081053-73081075 AGTGCTGTGAAGAATGTCAATGG - Intergenic
909805409 1:79868640-79868662 AATGCTGTGAAGAAAGTCAATGG + Intergenic
909992056 1:82235640-82235662 AATTCTTTGAAGAATGTCAATGG + Intergenic
910190857 1:84593957-84593979 AATTCTGTGAAGAATGTCAATGG - Intergenic
910308031 1:85789088-85789110 AATTCTGTGAAGAATGTCAATGG + Intronic
910736384 1:90462627-90462649 AATTCTATGAAGAATGTCTTTGG - Intergenic
910950286 1:92639733-92639755 AATTCTGTGAAGAATGTCAATGG - Intronic
911202865 1:95063807-95063829 AATTCTGTGAAGAATGTAAATGG + Intronic
911458308 1:98155723-98155745 AATGCTATGTTGAATGTGAGTGG - Intergenic
911492259 1:98584979-98585001 AATTCTGTGAAGAATGTCAATGG - Intergenic
911561543 1:99412069-99412091 AATTCTGTGAAGAATGTCAATGG + Intergenic
911675277 1:100651741-100651763 AATTCTGTGAAGAATGTCAATGG - Intergenic
911744535 1:101425823-101425845 AGTTCTATGAAGAATGTCAATGG + Intergenic
911785092 1:101936572-101936594 AATTCTGTGAAGAATGTTGTTGG - Intronic
911794881 1:102063041-102063063 AATTCTGTGAAGAATGTGAATGG - Intergenic
911800603 1:102133222-102133244 AATTATGTGAAGAATGTTGATGG - Intergenic
911979544 1:104549689-104549711 AATTCTGTGAAGAATGTCAATGG - Intergenic
912007269 1:104919815-104919837 AATTCTATGAAGAAAGTCAATGG - Intergenic
912127060 1:106552372-106552394 AATTCTGTGAAGAATGTCAATGG + Intergenic
912166747 1:107050584-107050606 AATTCTGTGAAGAATGTCAATGG + Intergenic
912900761 1:113645560-113645582 AATGCTAAGATGTATGGGGAAGG + Intronic
913035819 1:114964888-114964910 AATTCTATGAAGAAAGTCAATGG + Intronic
913713130 1:121506932-121506954 AATTCTGTGAAGAATGTCAATGG - Intergenic
914968713 1:152286931-152286953 AATTCTATGAAGAATGTCATTGG - Intergenic
915062609 1:153198693-153198715 CATGTTAGGAAAAATGTGGAAGG + Intergenic
915659121 1:157387600-157387622 AAATCTGTGAAGAATATGGATGG + Intergenic
915692724 1:157705926-157705948 AATTCTGTGAAGAATGTCAATGG - Intergenic
916594374 1:166229180-166229202 AATACTGTGAAGAATGTCAATGG + Intergenic
916827702 1:168458552-168458574 AATTCTGTGAAGAATGTCAATGG + Intergenic
917022904 1:170609757-170609779 AATTCTGTGAAGAAAGTGAATGG + Intergenic
917024631 1:170628777-170628799 AATTCTGTGAAGAATGTCAATGG + Intergenic
917033855 1:170724806-170724828 AATTCTGTGAACAATGTGAATGG + Intronic
917046716 1:170868711-170868733 AATTCTATGAAGAATGTCAATGG + Intergenic
917053819 1:170956341-170956363 AATTCTATGAAGAATGTTGGTGG + Intronic
917060131 1:171028552-171028574 AATTCTGTGAAGAATGTCAATGG + Intronic
917270089 1:173263248-173263270 AATTCTGTGAAGAATGTCAATGG - Intergenic
917295267 1:173512177-173512199 AATTCTGTGAAGAATGTCAATGG + Intronic
917584486 1:176412225-176412247 AATTCTATGAAGAAAGTCAATGG + Intergenic
917622778 1:176814309-176814331 AATCCTGTGAAGAATGTCAATGG + Intronic
917682362 1:177380433-177380455 AATTCTGTGAAGAATGTCAATGG + Intergenic
917887509 1:179400956-179400978 AATGATAAAAAGAATGTGTACGG + Intronic
918056265 1:181024147-181024169 TATGCTATGAAATTTGTGGATGG + Intergenic
918122655 1:181553025-181553047 AATTCTGTGAAGAATGTCAATGG + Intronic
918172269 1:182009831-182009853 AATTCTGTGAAGAATGATGATGG - Intergenic
918672605 1:187238775-187238797 AATGCTATGAAGCATGAAAACGG - Intergenic
918782499 1:188719454-188719476 AATTCTGTGAAGAATGATGATGG + Intergenic
918801819 1:188982106-188982128 AATTCTGTGAAGAATGTCAATGG + Intergenic
918943595 1:191031814-191031836 AATTCTGTGAAGAATGTCAAAGG - Intergenic
918955583 1:191202752-191202774 AATTCTGTGAAGAATGTCAATGG - Intergenic
918958972 1:191246258-191246280 AATTCTATGAAGAATGTTACTGG + Intergenic
918972513 1:191437900-191437922 AGTTCTATGAAGAATGATGATGG - Intergenic
918975194 1:191474993-191475015 AATTCTATGAAGAAAGTCAATGG - Intergenic
918982537 1:191581929-191581951 AATTCTGTGAAGAATGTCCATGG + Intergenic
919205511 1:194417311-194417333 GATGCCATGAAGAAAGTGGAGGG + Intergenic
921261460 1:213388469-213388491 AATTGCATGAAGAATGTGGGAGG - Intergenic
921339918 1:214124531-214124553 AATGCCCTGAAGCATTTGGAAGG - Intergenic
921611336 1:217215692-217215714 AATTCTGTGAAGAATGTCAATGG + Intergenic
921783441 1:219197099-219197121 AATTCTGTGAAGAATGTCAATGG - Intronic
921919136 1:220646521-220646543 AATTCTGTGAAGAATGTCAATGG - Intronic
922069493 1:222177309-222177331 AATTCTGTGAAGAATGTCAATGG + Intergenic
922081023 1:222296895-222296917 AATTCTGTGAAGAATGTCAATGG - Intergenic
922346550 1:224701162-224701184 ACTGCTATGCAGAGAGTGGAAGG + Intronic
922399218 1:225234570-225234592 AGTTCTGTGAAGAATGTCGATGG + Intronic
922658310 1:227405691-227405713 AATTCTATGAAGAATGATGGTGG - Intergenic
922666941 1:227478493-227478515 AATTCTGTGAAGAATGTCAATGG - Intergenic
922971390 1:229743515-229743537 AATTCTATGAAGAATGTCATTGG + Intergenic
923195058 1:231658005-231658027 AATTCTGTGAAGAATGTCAATGG + Intronic
923570485 1:235108787-235108809 AATGCTTTGGAGAGGGTGGAAGG - Intergenic
923730560 1:236545804-236545826 AAAGCTGGGAAGGATGTGGAAGG + Intronic
923945920 1:238887475-238887497 AATTCTGTGAAGAATGTAAATGG - Intergenic
924109061 1:240679934-240679956 AATTCTGTGAAGAATGTCAATGG - Intergenic
924613738 1:245594693-245594715 AATTCTATGAAGAAAGTCAATGG + Intronic
924779789 1:247136610-247136632 AATTCTGTGAAGAATGTCAATGG - Intronic
924876200 1:248107100-248107122 AATTCTATGAAGAAAGTCAAAGG + Intergenic
924884085 1:248193565-248193587 AATTCTGTGAAGAATGTCAATGG - Intergenic
1062946178 10:1464042-1464064 AATGCTGACAAGGATGTGGAGGG + Intronic
1062983973 10:1749410-1749432 ACAGCTATGATGAATGTGCAAGG + Intergenic
1063261224 10:4391743-4391765 AATGTTATGAAGACTGTGGTAGG + Intergenic
1063524726 10:6774207-6774229 AAAGCTAAGAAGAATGTGGGAGG - Intergenic
1064370072 10:14743878-14743900 AATTCTGTGAAGAATGTCAATGG + Intronic
1064395289 10:14976775-14976797 AATATTATGAAGAATATGAAAGG - Intronic
1064632704 10:17333357-17333379 AATTCTGTGAAGAATGTCAATGG - Intronic
1065068128 10:21993553-21993575 ATTGCTATTAAAAATGTTGAGGG - Intronic
1065100923 10:22332857-22332879 AATGCAATGAAGACTGTGTGGGG - Intergenic
1065198211 10:23287091-23287113 AATTCTGTGAAGAATGTCAATGG - Intronic
1065461207 10:25966453-25966475 AGTGCTATGAAGAATATAAAAGG + Intronic
1065461643 10:25973007-25973029 AATTCTGTGAAGAATGTCAATGG + Intronic
1066113210 10:32215844-32215866 AATGATATGAAGAACGTAGTAGG + Intergenic
1066224062 10:33365279-33365301 AATGGCAGGAAGAATGTGAATGG - Intergenic
1066249474 10:33618843-33618865 AATATTGTGAAGAATGTGTAAGG - Intergenic
1066699304 10:38109957-38109979 AATTCTGTGAAGAATGTTAATGG - Intronic
1067050693 10:43017639-43017661 AATTCTGTGAAGAATGTCAATGG + Intergenic
1067130730 10:43563016-43563038 AATAATATGAAGAATGAGGCCGG + Intronic
1067198525 10:44144956-44144978 AATTCTGTGAAGAATGTCAATGG - Intergenic
1067236611 10:44456077-44456099 AATTCTATGAAGAATGTCAATGG + Intergenic
1067256149 10:44644241-44644263 AATTCTATGAAAAATGTCAATGG - Intergenic
1067413153 10:46082740-46082762 AATTCTGTGAAGAATGTCGATGG + Intergenic
1067920361 10:50449559-50449581 AAGGACATGAAGAAAGTGGAGGG - Intronic
1067923663 10:50485512-50485534 AATTCTGTGAAGAATGTCAATGG - Intronic
1068126417 10:52846794-52846816 AATTCTGTGAAGAATGTCAATGG + Intergenic
1068341813 10:55714109-55714131 AAGGCCAGGAAGAATATGGAGGG - Intergenic
1068611650 10:59066951-59066973 CACTCTATGAAGAATTTGGAGGG - Intergenic
1068718531 10:60215873-60215895 AATTCTGTGAAGAATGTCAATGG + Intronic
1068810759 10:61253316-61253338 AATTCTGTGAAGAATGTCAATGG + Intergenic
1070205909 10:74261204-74261226 AAGGCTATAAATAATGTGGTGGG - Intronic
1070667710 10:78357140-78357162 AATGCCTTGCAGAATGTGAATGG + Intergenic
1071016373 10:81001851-81001873 AATGCAATGAAAAATTTTGATGG - Intergenic
1071035060 10:81234828-81234850 AATTCTGTGAAGAATGTCAATGG + Intergenic
1071076819 10:81764722-81764744 AATTCTGTGAAGAATGTCAATGG + Intergenic
1071134128 10:82433974-82433996 AATTCTGTGAAGAATGTCAATGG + Intronic
1071195031 10:83148806-83148828 AATTCTGTGAAGAATGTAGATGG - Intergenic
1071316989 10:84411326-84411348 AATTCTGTGAAGAATGTCAATGG + Intronic
1071706032 10:87999575-87999597 AATTCTGTGAAGAATGTCAATGG - Intergenic
1071848634 10:89545677-89545699 AATTCTGTGAAGAATGTCAATGG - Intronic
1071913643 10:90265354-90265376 AATTCTATGAAGAATGTCAATGG - Intergenic
1072420885 10:95290176-95290198 AATGCTAGGAAGAATGACGGCGG + Intronic
1072679309 10:97494854-97494876 AATGCAATGAGAAATGTTGAAGG - Intronic
1072854372 10:98931492-98931514 AATTCTGTGAAGAATGTCAATGG + Intronic
1073223447 10:101895713-101895735 AATGCCATCAAGAAAGTGAAAGG + Intronic
1073588624 10:104734906-104734928 AATGAGATGAAGTATGTGCAGGG + Intronic
1073674720 10:105632777-105632799 AATTCTGTGAAGAATGTCAATGG + Intergenic
1073717024 10:106119237-106119259 AATTCTATGAAGAATGTCAATGG - Intergenic
1073772707 10:106752762-106752784 AATGCTAAGGAGAATGGGGGAGG + Intronic
1073775829 10:106784999-106785021 CAAGGGATGAAGAATGTGGATGG - Intronic
1073820068 10:107251710-107251732 AATGATGTGAATACTGTGGATGG - Intergenic
1073872007 10:107876406-107876428 AATTCTTTGAAGAATGTCAATGG - Intergenic
1073910177 10:108332874-108332896 AATTCTATGAAGAATATTAATGG + Intergenic
1073948428 10:108779401-108779423 AATTCTTTGAAGAATGTCAATGG + Intergenic
1074634687 10:115301508-115301530 AATGCTATGGAAAACGTGGCTGG + Intronic
1074733372 10:116401275-116401297 ATTGCAAGGAAGAAAGTGGAAGG + Intergenic
1074850581 10:117436385-117436407 AATGCTATGAAGTAGGTAGAAGG - Intergenic
1075187946 10:120279927-120279949 AATTCTATGAAGAATGTCATTGG - Intergenic
1075230835 10:120675776-120675798 AATTCTGTGAAGAATGTCAATGG - Intergenic
1075494161 10:122905009-122905031 AATTCTGTGAAGAATGGTGATGG - Intergenic
1076000350 10:126907972-126907994 AATGCTAGGAAAGATGTGAAGGG + Intronic
1076107871 10:127838236-127838258 AATTCTGTGAAGAATGTCAATGG + Intergenic
1076174450 10:128356596-128356618 AATTCTGTGAAGAATGTCAATGG + Intergenic
1076511712 10:131018970-131018992 AATGAGATAAAGAATGTGAAAGG + Intergenic
1077246774 11:1543554-1543576 TATGCTATGAATCATGTGGCCGG - Intergenic
1077396072 11:2322442-2322464 AATTCTGTGAAGAATGTCAATGG - Intergenic
1077697512 11:4407781-4407803 AATTCTATGAAGAAAGTCAAGGG - Intergenic
1077966878 11:7144076-7144098 GATGCTAAGAAGACTGTAGAGGG + Intergenic
1078289022 11:9987884-9987906 AATTCTGTGAAGAATGATGATGG - Intronic
1078691718 11:13587221-13587243 AATACTGTGAAGAATGTCAATGG - Intergenic
1078835175 11:15020901-15020923 AATTCTGTGAAGAATGTCAATGG - Intronic
1079255590 11:18825970-18825992 AATTCTGTGAAGAATGATGATGG + Intergenic
1079257280 11:18842459-18842481 AATTCTGTGAAGAATGTCAATGG - Intergenic
1079261176 11:18882928-18882950 AATTCTGTGAAGAATGTGAATGG - Intergenic
1079426488 11:20347256-20347278 AATTCTGTGAAGAATGTCAATGG - Intergenic
1079579953 11:22051670-22051692 AATTCTGTGAAGAATGTCAATGG + Intergenic
1079690360 11:23409353-23409375 AATTCTGTGAAGAATGTCAATGG + Intergenic
1079705732 11:23615463-23615485 AATTCTATGAAGAATGTCAATGG + Intergenic
1079777127 11:24545811-24545833 AATTCTATGAAGAATGTCATTGG + Intronic
1079902959 11:26210508-26210530 AATTCTGTGAAGAAAGTGAATGG + Intergenic
1079934837 11:26604438-26604460 AATTCTGTGAAGAATGTCAATGG + Intronic
1080033177 11:27683930-27683952 AATTCTATGAAGAAAGTCAATGG + Intronic
1080095880 11:28406133-28406155 AATTCTGTGAAGAATGTCAATGG + Intergenic
1080164477 11:29220515-29220537 AATTCTGTGAAGAATGTCAATGG + Intergenic
1080292998 11:30692087-30692109 AATTCTGTGAAGAATGTCAATGG - Intergenic
1080329908 11:31124398-31124420 AATTCTTTGAAGAATGTCAATGG - Intronic
1080456276 11:32422417-32422439 AATGATAGGCAGAAGGTGGAAGG - Intronic
1081079803 11:38727647-38727669 AATTCTATGAAGAAAGTCAATGG + Intergenic
1081166489 11:39814541-39814563 AATTCTATGAAGAAAGTGAATGG - Intergenic
1081189765 11:40088939-40088961 AATACCATGAATATTGTGGAGGG + Intergenic
1081269857 11:41069882-41069904 AATTCTGTGAAGAATGTCAATGG - Intronic
1081394235 11:42566270-42566292 AATTCTGTGAAGAATGTCAATGG + Intergenic
1081409014 11:42733665-42733687 AATGCTGTGAAGAATGTCATTGG - Intergenic
1081439938 11:43069122-43069144 AATTCTGTGAAGAATGTCAATGG - Intergenic
1081454547 11:43208233-43208255 AATTCTGTGAAGAATGTCAATGG + Intergenic
1081798252 11:45837632-45837654 AATTCTATGAAGAAAGTCGATGG - Intergenic
1082674265 11:56076482-56076504 AATTCTGTGAAGAATGTCAATGG + Intergenic
1082702908 11:56455531-56455553 AATGCTGTGAAGAATGATGTTGG + Intergenic
1082925036 11:58536125-58536147 AATTCTATGAAGAAAGTCAATGG - Intronic
1082950982 11:58815778-58815800 AATTCTGTGAAGAAAGTCGATGG + Intergenic
1083125581 11:60562488-60562510 AATCCTGTGAAGAATGTCAATGG + Intergenic
1083401043 11:62423735-62423757 AAAGCTTTGAAGGATGGGGAGGG - Intergenic
1083527686 11:63385318-63385340 AATTCTTTGAAGAATGTCAATGG + Intronic
1085215668 11:74828445-74828467 AATTCTGTGAAGAATGTCAATGG - Intronic
1085334760 11:75683669-75683691 AATTCTGTGAAGAATGTAAATGG + Intergenic
1085657179 11:78326957-78326979 AAGGCTAAGAAGAAATTGGATGG + Intronic
1085683366 11:78598951-78598973 AATTCTGTGAAGAATGTCAATGG + Intergenic
1085917543 11:80907640-80907662 AATTCTGTGAAGAATGGTGATGG - Intergenic
1086301923 11:85435777-85435799 AATTCTGTGAAGAATGTCAATGG - Intronic
1086451177 11:86918531-86918553 AATGCTATGAAGACAGAGAAGGG - Intronic
1086514266 11:87593604-87593626 AATTCTGTGAAGAATGTCAATGG - Intergenic
1087294045 11:96348975-96348997 AATTCTGTGAAGAATGTTAATGG + Intergenic
1087316601 11:96610640-96610662 AATTCTGTGAAGAATGTCAATGG + Intergenic
1087353916 11:97070186-97070208 AATTCTGTGAAGAATGTCAATGG + Intergenic
1087429519 11:98034804-98034826 AATGCTGTGAAGAATGATGGTGG - Intergenic
1087553972 11:99690496-99690518 AATTCTGTGAAGAATGTCCATGG + Intronic
1087620169 11:100531730-100531752 AATTCTATGAAGGATGTCAATGG - Intergenic
1088005228 11:104931683-104931705 AATTCTGTGAAGAATGTCAATGG - Intergenic
1088037738 11:105337655-105337677 AATTCTGTGAAGAATGTCAATGG - Intergenic
1088167134 11:106952263-106952285 AATTCTGTGAAGAATGTCAATGG + Intronic
1088515659 11:110630380-110630402 AATTCAATGAAGAATGTGATGGG - Intronic
1088690951 11:112327139-112327161 AATTCTATGAAGAAAGTCCATGG + Intergenic
1088960256 11:114656395-114656417 AATTCTGTGAAGAATGTCAATGG - Intergenic
1089939512 11:122400865-122400887 AATTCTGTGAAGAATGTCAATGG - Intergenic
1090559594 11:127917321-127917343 AATTCTGTGAAGAATGTAAATGG - Intergenic
1091811457 12:3401946-3401968 AATTCTGTGAAGAATGTCAATGG - Intronic
1092512779 12:9174927-9174949 AATTCTGTGAAGAATGTCAATGG - Intronic
1093340061 12:17963108-17963130 AATTCTATGAAAAATGTCAATGG + Intergenic
1093403806 12:18780096-18780118 AATTCTGTGAAGAATGTCAATGG - Intergenic
1093408352 12:18834054-18834076 AATTCTGTGAAGAATGTCAATGG + Intergenic
1093413232 12:18891754-18891776 AATTCTGTGAAGAATGTCAATGG + Intergenic
1093522917 12:20071371-20071393 AATTCTGTGAAGAATGTCAACGG - Intergenic
1093595972 12:20960003-20960025 AATTCTGTGAAGAATGTCAATGG - Intergenic
1093808875 12:23468853-23468875 AATTCTGTGAAGAATGTTAATGG - Intergenic
1093887439 12:24478745-24478767 AATGCAATGGAGAAAATGGATGG - Intergenic
1094055109 12:26261081-26261103 AATTCTGTGAAGAATGTCAACGG - Intronic
1094262651 12:28519072-28519094 AATTCTGTGAAGAATGTTGGTGG + Intronic
1094277529 12:28695115-28695137 ATTGCTATGGAGAATGTTAAAGG + Intergenic
1094694632 12:32805830-32805852 AATTCTGTGAAGAATGTCAATGG + Intronic
1094775929 12:33727624-33727646 AATTCTGTGAAGAATGTCAATGG + Intergenic
1094811738 12:34145053-34145075 AATTCTGTGAAGAATGTCAATGG - Intergenic
1095127547 12:38499900-38499922 AATTCTATGAAGAAAGTCAATGG - Intergenic
1095319958 12:40815176-40815198 AATTCTGTGAAGAATGTCAATGG + Intronic
1095353074 12:41237995-41238017 AATTCTGTGAAGAATGTCAATGG + Intronic
1095405672 12:41864418-41864440 AATTCTGTGAAGAATGTCAATGG - Intergenic
1095416747 12:41985506-41985528 AATTCTGTGAAGAATGTCAATGG - Intergenic
1095422191 12:42036528-42036550 ATTTCTATGAAGAATGTGATTGG - Intergenic
1095509925 12:42940017-42940039 AATTCTGTGAAGAATGTCAATGG + Intergenic
1095538013 12:43275157-43275179 AATTCTGTGAAGAATGTCAATGG - Intergenic
1095595726 12:43955754-43955776 AATTCTGTGAAGAATGTCAACGG - Intronic
1095688083 12:45058498-45058520 AATTCTATGAAGGTTGTGGGAGG - Intergenic
1096051252 12:48610509-48610531 AATTCTATGAAGAATCTCAATGG + Intergenic
1096928858 12:55181762-55181784 AATTCTGTGAAGAATGTCAATGG + Intergenic
1097312649 12:58137527-58137549 AATTCTGTGAAGAATGTCAATGG + Intergenic
1097364265 12:58693945-58693967 AATTCTGTGAAGAATGTGAGTGG - Intronic
1097410529 12:59247129-59247151 AATTATATGAAGAATGTCAATGG - Intergenic
1097456107 12:59800535-59800557 AATTCTGTGAAGAATGTCAAGGG - Intergenic
1097600719 12:61689144-61689166 AATTCTGTGAAGAATGTCAATGG - Intergenic
1097737729 12:63200821-63200843 AATTCTATGAAGAAAGTCAATGG - Intergenic
1097906566 12:64925882-64925904 AGTTCTATGAAGAATGATGATGG + Intergenic
1097910301 12:64962252-64962274 AATTCTGTGAAGAATGTCAATGG + Intergenic
1098054482 12:66490095-66490117 AATTCTGTGAAGGATGTCGATGG - Intronic
1098416372 12:70239875-70239897 AATGCTATTAAGAAAATAGAGGG + Intergenic
1099369954 12:81816841-81816863 AATGCTGTGATGAATGTCAATGG - Intergenic
1099486767 12:83238450-83238472 AATTCTATGAAGAATGTCAATGG + Intergenic
1099590338 12:84579038-84579060 AATACTGTGAAGAATGTCAATGG - Intergenic
1100055920 12:90509405-90509427 AATTCTTTGAAGAATGTCAATGG + Intergenic
1100406039 12:94273598-94273620 AATGCCAGGTAGAATGTGGGAGG - Intronic
1100689875 12:97028564-97028586 AATGCTATGAAGAAAAAGCAAGG + Intergenic
1100743616 12:97622101-97622123 AACACTATGAAGTTTGTGGAAGG + Intergenic
1100815398 12:98382157-98382179 AATTCTGTGAAGAATGTTAATGG - Intergenic
1100923043 12:99511528-99511550 AATTCTGTGAAGAATGTCAATGG - Intronic
1100950593 12:99844761-99844783 AATTCTATGAAGAATGTCAATGG + Intronic
1101066992 12:101032048-101032070 AATTCTGTGAAGAATGTCAATGG - Intronic
1101134849 12:101732557-101732579 AATGATTTAAAGTATGTGGAAGG - Intronic
1101634893 12:106531297-106531319 AATTCTGTGAAGAATGATGATGG + Intronic
1102121986 12:110449076-110449098 AATGCTATAAAGAAGCTAGATGG - Intronic
1102268682 12:111511027-111511049 GTTGCTATAAAGAATGTGTAGGG - Intronic
1104100409 12:125603072-125603094 AATTCTGTGAAGAATGTAAATGG - Intronic
1104255968 12:127138809-127138831 AATTCTCTGAAGAATGTCAATGG + Intergenic
1104772843 12:131374981-131375003 AATGTTAAGAAGAATGAGGTTGG + Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1105668061 13:22582408-22582430 AATTCTGTGAAGAATGTCAATGG + Intergenic
1105821880 13:24087300-24087322 AATGCTTTGCAGAGTGTGCAGGG - Intronic
1105835295 13:24205549-24205571 AATTCTGTGAAGAATGTTAATGG - Intronic
1105866416 13:24464263-24464285 AATTCTGTGAAGAATGTCAATGG - Intronic
1105931177 13:25053975-25053997 AATTCTATGAAGAATGATGGTGG - Intergenic
1106805825 13:33305942-33305964 AATTCTGTGAAGAATGTCAATGG - Intronic
1107512400 13:41097685-41097707 AATTCTGTGAAGAATGTCAATGG + Intergenic
1107570567 13:41653525-41653547 AATTCTATGAAGAATGCCAATGG - Intronic
1107588170 13:41874719-41874741 AAAGGTATGAAGAAAGTAGATGG - Intronic
1107637654 13:42408678-42408700 AAAGCTATCTAGAATGTGAATGG - Intergenic
1107980069 13:45726804-45726826 AATGCTATGAAGAAAGTAATAGG + Intergenic
1108130777 13:47297848-47297870 AATTCTGTGAAGAATGTTGTTGG + Intergenic
1108173550 13:47769015-47769037 AATTCTGTGAAGAATGTCAATGG + Intergenic
1108551210 13:51546844-51546866 AATTCTATGAAGAAAGTCAATGG + Intergenic
1108562869 13:51664047-51664069 AATGAAAGGAAGAAAGTGGAAGG + Intronic
1108908101 13:55504645-55504667 AATTCTGTGAAGAATGTCAAAGG + Intergenic
1109329107 13:60905539-60905561 AATTCTATGAAGAAAGTCAATGG - Intergenic
1109403609 13:61868665-61868687 AATGCTATGCAGAATGTCAATGG + Intergenic
1109403625 13:61868810-61868832 AATGCTGTGAAGAATGGCAATGG + Intergenic
1109407772 13:61923634-61923656 AATTCTTTGAAGAATGTCAATGG + Intergenic
1109628921 13:65018096-65018118 AATTCTGTGAAGAATGTCAATGG + Intergenic
1109661285 13:65463841-65463863 AATTCTGTGAAGAATGTCAATGG + Intergenic
1109928286 13:69177485-69177507 AATTCTATGAAGAATGATGTGGG - Intergenic
1110010545 13:70327487-70327509 CATTCTGTGAAGAATGTGAATGG + Intergenic
1110128952 13:71982488-71982510 AATTCTGTGAAGAATGTCAATGG + Intergenic
1110337704 13:74351180-74351202 AATTCTGTGAAGAATGTCAATGG - Intergenic
1110402728 13:75112788-75112810 AATTCTGTGAAGAATGTCAATGG - Intergenic
1110488745 13:76077728-76077750 AATTCTGTGAAGAATGTCAATGG + Intergenic
1110548080 13:76779226-76779248 GATTCTATGATGAAGGTGGAAGG - Intergenic
1111092604 13:83466414-83466436 AATTCTGTGAAGAATGTCTATGG - Intergenic
1111224594 13:85252863-85252885 AATTCTATGAAGAAGGTCAATGG + Intergenic
1111508587 13:89229605-89229627 AATTCTATGAAGAATGATGTTGG + Intergenic
1111642120 13:90981708-90981730 AATTCTGTGAAGAATGTCAATGG - Intergenic
1111699735 13:91671692-91671714 AATTCTGTGAAGAATGTTAATGG - Intronic
1111704632 13:91733046-91733068 AATTCTGTGAAGAATGTCAATGG + Intronic
1111763551 13:92497630-92497652 AATTCTGTGAAGAATGTCAATGG + Intronic
1112081506 13:95976669-95976691 AATTCTGTGAAGAAAGTTGATGG - Intronic
1112102613 13:96206424-96206446 AATTCTGTGAAGAATGTCAATGG - Intronic
1112579393 13:100665367-100665389 ACTGCGATGAAGAATCTTGATGG - Intronic
1112648026 13:101357650-101357672 AATTCTGTGAAGAATGTCAATGG - Intronic
1112697095 13:101962087-101962109 AATTCTGTGAAGAATGTCAATGG + Intronic
1112913405 13:104517935-104517957 AATTCTGTGAAGAATGTCAATGG + Intergenic
1113409966 13:110076634-110076656 AATTCTATGAAGAAAGTCAATGG + Intergenic
1113528116 13:110998163-110998185 AATTCTGTGAAGAATGTCAATGG - Intergenic
1113684009 13:112266879-112266901 AATTCTGTGAAGAATGTCAATGG - Intergenic
1114355757 14:21906240-21906262 AATGCTGTGAGGAAGGTGAATGG + Intergenic
1114505088 14:23204748-23204770 AATTCTATGAAGAATGATGGTGG + Intronic
1114706391 14:24731115-24731137 AATTCCATGAAGAATGTCAATGG - Intergenic
1115009685 14:28530072-28530094 AATGTTATGAAAAATGTTGTAGG + Intergenic
1115130118 14:30044846-30044868 AATTCTATGAAGAATGATGGTGG - Intronic
1115281048 14:31663764-31663786 AATTCTATGAAGAAAGTCAATGG + Intronic
1115764620 14:36610642-36610664 AATTCTGTGAAGAATGTCAATGG - Intergenic
1115859054 14:37664118-37664140 AATTCTGTGAAGAATGTCAATGG - Intronic
1115924612 14:38417089-38417111 AATTCTGTGAAGAATGTTAATGG - Intergenic
1115926743 14:38444293-38444315 ACTTCTATGAAGAATGTCGTTGG + Intergenic
1115928432 14:38463581-38463603 AATTCTGTGAAGAATGTCAATGG + Intergenic
1116066688 14:39993302-39993324 AATTCTGTGAAGAATGTCAATGG + Intergenic
1116075401 14:40104323-40104345 AATTCTGTGAAGAATGTCAATGG - Intergenic
1116147242 14:41089888-41089910 AATTTTTTGAAGAATGTGCATGG + Intergenic
1116320698 14:43458675-43458697 AATTCTGTGAAGAATGTCAATGG - Intergenic
1116544690 14:46150140-46150162 AATCCTGTGAAGAATGTCAATGG + Intergenic
1116970400 14:51058796-51058818 AATGCTCTGAAGATTATGGATGG + Intronic
1117031321 14:51673698-51673720 AACGCATTGAAAAATGTGGAGGG + Intronic
1117080438 14:52146373-52146395 AATTCTGTGAAGAATGTTAATGG + Intergenic
1117259628 14:54018160-54018182 AATTCTATGAAGAATGTCATTGG - Intergenic
1117575349 14:57092018-57092040 AATGCGCTGCAGAATGTGAAAGG + Intergenic
1117643507 14:57825979-57826001 AATTCTGTGAAGAATGTCAATGG - Intronic
1117655867 14:57955906-57955928 AATTCTATGAAGAAAGTCAATGG - Intronic
1117781202 14:59234157-59234179 AATTCTGTGAAGAATGTCAATGG + Intronic
1118061884 14:62148389-62148411 AATTCTGTGAAGAATGATGATGG - Intergenic
1118479398 14:66148729-66148751 AATTCTGTGAAGAATGTCAATGG - Intergenic
1118644904 14:67829009-67829031 AATTCTGTGAAGAATGTGAATGG + Intronic
1118982791 14:70730092-70730114 AAGGCAAGGAAGACTGTGGAGGG + Exonic
1119979752 14:79066511-79066533 AATTCTGTGAAGAATGTCAATGG + Intronic
1120321366 14:82965812-82965834 AATTCTGTGAAGAATGTCAATGG + Intergenic
1120489156 14:85154628-85154650 AATGCATAGAAGAATGTGGAAGG + Intergenic
1120605026 14:86564120-86564142 AATTCTGTGAAGAATGTCAATGG + Intergenic
1120624770 14:86811320-86811342 AATTCTGTGAAGAAAGTCGATGG + Intergenic
1120638280 14:86978557-86978579 AATTCTCTGAAGAATGTCAATGG - Intergenic
1120799939 14:88676597-88676619 AATTCTGTGAAGAATGTCAATGG - Intronic
1121143369 14:91561492-91561514 AATTCTGTGAAGAATGTCAATGG - Intergenic
1123103882 14:105827151-105827173 AATTCTGTGAAGAATGATGATGG + Intergenic
1123884720 15:24714593-24714615 AATTCTATGAAGAATGTCAGTGG + Intergenic
1124046128 15:26151539-26151561 AATTCTGTGAAGAATGTCAATGG + Intergenic
1124113186 15:26812405-26812427 AATTCTGTGAAGAATGTCAATGG - Intronic
1124197343 15:27643710-27643732 AATTCTGTGAAGAATGTCAATGG - Intergenic
1124224470 15:27880379-27880401 AATTCTGTGAAGAATGTCAATGG + Intronic
1124387087 15:29218431-29218453 AATCCTATGAAGAATGGTGGTGG - Intronic
1124403114 15:29367669-29367691 ACTGCCTTGCAGAATGTGGAAGG + Intronic
1124668236 15:31612760-31612782 AATTCTGTGAAGAATGACGATGG - Intronic
1124874303 15:33577233-33577255 AATTCTGTGAAGAATGTCAATGG - Intronic
1125053961 15:35335909-35335931 AATTCTGTGAAGAATGTCAATGG + Intronic
1125084686 15:35716187-35716209 AATTCTGTGAAGAATGTCAATGG + Intergenic
1125119673 15:36139553-36139575 AATTCTGTGAAGAATGTCAATGG + Intergenic
1125127737 15:36243937-36243959 AATTCTATGAAGAATGTCAATGG - Intergenic
1125235442 15:37507594-37507616 AATTCTGTGAAGAATGTCAATGG + Intergenic
1125784040 15:42299571-42299593 AATTCTGTGAAGAATGTCAATGG - Intronic
1126278057 15:46908046-46908068 AATTCTGTGAAGAATGTCAATGG + Intergenic
1126284158 15:46992278-46992300 AATTCTGTGAAGAATGTCAATGG + Intergenic
1126514017 15:49514122-49514144 AATTCTGTGAAGAATGTCAATGG + Intronic
1126784749 15:52168583-52168605 TATTCTATGAAGAATGTCAATGG - Intronic
1126869200 15:52969595-52969617 CATGCACTAAAGAATGTGGATGG + Intergenic
1126997074 15:54456378-54456400 AATTCTGTGAAGAATGATGATGG + Intronic
1127030434 15:54855703-54855725 AATTCTATGAAGAAAGTCAATGG - Intergenic
1127100562 15:55560645-55560667 AATTCTGTGAAGAATGTCAATGG - Intronic
1127335191 15:57977739-57977761 AATTCTATGAAGAAAGTCAATGG + Intronic
1127338676 15:58017496-58017518 AATGCTATGGAGAAATTTGAGGG - Intronic
1128857715 15:71033503-71033525 AATTCTGTGAAGAATGTCAATGG - Intronic
1128891918 15:71339153-71339175 AATGCTATGAAGAACCCAGAGGG - Intronic
1128941861 15:71794551-71794573 AATTCTGTGAAGAAAGTCGATGG + Intronic
1129001065 15:72334329-72334351 AATGTTATAAAGAATGAGGCTGG - Intronic
1130129244 15:81123564-81123586 AGTTCTATGAAGAATGTCAATGG + Intronic
1130848717 15:87772474-87772496 AATTCTGTGAAGAATGTCAATGG - Intergenic
1131389886 15:92038718-92038740 AATTCTATGAAGAATATCCATGG - Intronic
1131917803 15:97289932-97289954 AATTCTGTGAAGAATGTTGTTGG + Intergenic
1131942172 15:97579006-97579028 AATACTGTGAAGAATGTCAATGG + Intergenic
1132035795 15:98483112-98483134 AATGCTATGAAGAATGTGGATGG - Intronic
1132254392 15:100362930-100362952 AATTCTGTGAAGAAAGTCGATGG - Intergenic
1132259887 15:100414394-100414416 AATTCTGTGAAGAATGTCAATGG - Intronic
1132308673 15:100838703-100838725 ACTGCTATGAATAATGAAGAAGG + Intergenic
1133093284 16:3422248-3422270 AATTCTATGAAGAATGTCATTGG + Intronic
1134188530 16:12103169-12103191 AATTCTGTGAAGAAAGTGCATGG - Intronic
1134246106 16:12541340-12541362 AATTCTGTGAAGAATGAAGAAGG - Intronic
1134358966 16:13512470-13512492 AATTCTGTGAAGAATGTCAATGG - Intergenic
1135177509 16:20243798-20243820 GAAGCTAAGAAGATTGTGGAAGG - Intergenic
1135286431 16:21197419-21197441 AATCTTAATAAGAATGTGGAAGG + Intergenic
1135383175 16:22010262-22010284 AAAGATATGAAGAATCAGGATGG + Intronic
1135782433 16:25315807-25315829 AGTTCTATGAAGAATGTCGTTGG - Intergenic
1136643106 16:31584566-31584588 AATTCTGTGAAGAATGTCAATGG + Intergenic
1136659458 16:31743647-31743669 AATTCTGTGAAGAATGTCAATGG + Intronic
1136662487 16:31776274-31776296 AATTCTGTGAAGAATGTCAATGG - Intronic
1136677915 16:31930601-31930623 AATTCTATGAAGAATGTCATTGG - Intergenic
1138103609 16:54274611-54274633 TATGCTGTGAAGTATCTGGAAGG + Intergenic
1138390197 16:56664806-56664828 AATGACATGAAGAATGGGAAAGG + Intronic
1138837406 16:60455514-60455536 AATTCTGTGAAGAATGTCAATGG + Intergenic
1138843241 16:60534824-60534846 AATTCTGTGAAGAATGTCAATGG + Intergenic
1138848359 16:60595532-60595554 AATTCTGTGAAGAATGTCAATGG - Intergenic
1138868821 16:60855522-60855544 AATGCTATTAAGACTATGTAAGG + Intergenic
1139097573 16:63723401-63723423 AATTCTGTGAAGAATGTCAATGG + Intergenic
1140030386 16:71332849-71332871 AATTCTGTGAAGAATGTCAATGG - Intergenic
1140437777 16:74962310-74962332 AATTCTGTGAAGAATGTCAATGG + Intronic
1140954829 16:79853070-79853092 AATTCTGTGAAGAATGTCAATGG + Intergenic
1141415398 16:83868159-83868181 AATTCTGTGAAGAATGTCAATGG - Intergenic
1142924068 17:3217393-3217415 AATTCTGTGAAGAATGTCAATGG - Intergenic
1142943723 17:3406642-3406664 AATGCTATGAAGAATGTCAATGG + Intergenic
1143278001 17:5728516-5728538 AATTCTGTGAAGAATGATGATGG - Intergenic
1144410783 17:14999188-14999210 AATTCAAGGAAGAATGTGGTGGG + Intergenic
1144432351 17:15205466-15205488 AATTCCATGAAGAATGTCAATGG - Intergenic
1145037958 17:19554292-19554314 AAGGCTAAGAAGGATGTTGAGGG + Intronic
1146760451 17:35472676-35472698 AATTCTGTGAAGAATGTCAATGG + Intronic
1146785493 17:35717236-35717258 ATTGCCAAGAGGAATGTGGAAGG + Exonic
1147049568 17:37782208-37782230 AATTCTGTGAAGAATGTCAATGG + Intergenic
1148657264 17:49296095-49296117 AATGCCAAGGAGACTGTGGAGGG + Exonic
1149174846 17:53857390-53857412 AATTCTGTGAAGAATGTCAATGG - Intergenic
1149229304 17:54514669-54514691 AATTCTGTGAAGAATGTCCATGG + Intergenic
1149241767 17:54659051-54659073 AATTCTGTGAAGAATGTCAATGG + Intergenic
1149377479 17:56059955-56059977 AATTCTGTGAAGAATGTCAATGG + Intergenic
1149405097 17:56340829-56340851 AGTTCTGTGAAGAATGTGAATGG + Intronic
1149631786 17:58131676-58131698 AATTCTATGAAGAAAGTCGTTGG - Intergenic
1150346727 17:64410505-64410527 ATTGCTCTTTAGAATGTGGAAGG + Intronic
1150881898 17:69039179-69039201 AATTCTATGAAGAAAGTCAACGG - Intronic
1153351790 18:4089417-4089439 AATTCTACGAAGAATGTCAATGG - Intronic
1153742862 18:8147173-8147195 AATTCTATGAAGAACGTCAATGG + Intronic
1154320906 18:13351155-13351177 AATTCTGTGAAGAATGTCAAAGG + Intronic
1154935214 18:21047828-21047850 AAGGATATGAAAAATGTTGAAGG - Intronic
1155124326 18:22856552-22856574 AATCCTAAGAAGAATATGGTTGG - Intronic
1155253627 18:23974911-23974933 AATTCTGTGAAGAATGTCAATGG + Intergenic
1156226071 18:35109483-35109505 AATTCTGTGAAGAATGTCAATGG + Intronic
1156230328 18:35147690-35147712 AATTCTGTGAAGAATGTCAATGG + Intergenic
1156241735 18:35261378-35261400 AATTCTGTGAAGAATGTCAATGG + Intronic
1156665052 18:39394690-39394712 AATTCTGTGAAGAATGTCGATGG - Intergenic
1156884936 18:42124121-42124143 AATTCTGTGAAGAATGTAAATGG - Intergenic
1156976264 18:43225194-43225216 AATTCTGTGAAGAATGATGATGG + Intergenic
1157011442 18:43653822-43653844 AATTCTGTGAAGAATGTCAATGG - Intergenic
1157056836 18:44239370-44239392 AATCCATTGAAAAATGTGGATGG + Intergenic
1157073072 18:44432372-44432394 AATTCTATGAAGAAAGTCAATGG + Intergenic
1157181204 18:45499836-45499858 AATGAAATAATGAATGTGGAGGG + Intronic
1157206512 18:45704759-45704781 AATGCTATGAACAATGTCATTGG - Intergenic
1157319386 18:46622657-46622679 AAGGCTCTGAAGATTGGGGAAGG + Intronic
1158001717 18:52627174-52627196 AGTGCTATGAAGGATGTATAGGG - Intronic
1158002994 18:52640831-52640853 AATTCTATGAAGAATGATGGTGG - Intronic
1158059055 18:53316483-53316505 AATTCTGTGAAGAAAGTCGATGG + Intronic
1158765194 18:60442527-60442549 AATTCTGTGAAGAATGTCAATGG + Intergenic
1158921207 18:62192907-62192929 AATTCTATGAAGAATGTCAATGG + Intronic
1158929390 18:62308021-62308043 AAAGCTATGGATAATGAGGATGG - Intergenic
1159155716 18:64579042-64579064 AATTCTGTGAAGAATGTCAATGG + Intergenic
1159368907 18:67506510-67506532 AATGCTATTAAGATTTTGTATGG - Intergenic
1159387712 18:67746957-67746979 AATTCTGTGAAGAATGTCAATGG - Intergenic
1159474239 18:68898791-68898813 ATTGCTAAGAATAAAGTGGAAGG + Intronic
1159564678 18:70035180-70035202 AGTTCTATGAAGAATGTGATTGG - Intronic
1159632733 18:70767620-70767642 CATTCTGTGAAGAATGTGAATGG - Intergenic
1159646605 18:70925575-70925597 AATTCTGTGAAGAATGTCAATGG - Intergenic
1159817164 18:73089315-73089337 AAGGATGTGAAGAATTTGGATGG - Intergenic
1159895135 18:73989199-73989221 AATGCTTTGAGGAATGGAGATGG + Intergenic
1160238704 18:77106721-77106743 CATGCCATGAAGCATGGGGAAGG - Intronic
1160263603 18:77318829-77318851 AATACTGAGAAGAATGTGGAAGG + Intergenic
1164135263 19:22408902-22408924 AATTCTGTGAAGAATGTTAATGG - Intronic
1164163353 19:22646046-22646068 AATTCTGTGAAGAATGTGAATGG + Intronic
1164264845 19:23605460-23605482 AATTCTGTGAAGAATGTCAATGG + Intronic
1164775479 19:30850319-30850341 AATGTAATGAACAATATGGATGG - Intergenic
1164960067 19:32420303-32420325 GCTGCTGTGAAGAATCTGGATGG + Intronic
1165677696 19:37742291-37742313 AATTCTGTGAAGAATGTCAATGG - Intronic
1165681052 19:37776100-37776122 AATTCTGTGAAGAATGGTGATGG - Intronic
1165682556 19:37790224-37790246 AATGTATTGAAGAATGTGGTGGG + Intronic
1166588574 19:43973862-43973884 AATTCTGTGAAGAATGTCAACGG - Intronic
1166595319 19:44042916-44042938 AATGTAATTAAGAATGTAGATGG - Intergenic
1166904372 19:46096045-46096067 AATTCTGTGAAGAATGTCAATGG + Intergenic
1167032985 19:46975797-46975819 GTGGCTATGATGAATGTGGAGGG - Intronic
1168516958 19:57016859-57016881 AGTGATATGAAAATTGTGGATGG + Intergenic
1202649553 1_KI270706v1_random:168255-168277 AATTCTATGAAGAAAGTCAATGG - Intergenic
925053775 2:839193-839215 AATTCTGTGAAGAATGTCAATGG - Intergenic
925420438 2:3706069-3706091 AAAGCTCTGAAAAATGTGGCTGG + Intronic
925447027 2:3935712-3935734 AATTCTGTGAAGAATGTCAATGG + Intergenic
925728691 2:6900347-6900369 AATTCTGTGAAGAAAGTCGATGG + Intergenic
926347340 2:11959953-11959975 AATTCTGTGAAGAATGTCAATGG - Intergenic
926513949 2:13817499-13817521 AATTCACTGAAAAATGTGGAAGG + Intergenic
926560551 2:14412632-14412654 AATTCTGTGAAGAATGATGATGG - Intergenic
926640997 2:15236806-15236828 AATGGTATGAACAATATAGAAGG - Intronic
926792912 2:16593607-16593629 AATGCTTTTAAAAATATGGATGG + Intronic
926873584 2:17450177-17450199 AATTCTGTGAAGAATGTCAATGG - Intergenic
926999294 2:18775710-18775732 AATGCTATAAAGAATTTTGTTGG + Intergenic
927440230 2:23110511-23110533 AATTCTGTGAAGAATGTCAATGG + Intergenic
927568022 2:24131353-24131375 AATTCTATGAAGAATGTCAATGG + Intronic
928083532 2:28330798-28330820 AATTCTGTGAAGAATGTCCATGG - Intronic
928354443 2:30597168-30597190 AATTCTATGAAGAATGTCAACGG + Intronic
928355176 2:30606205-30606227 AATTCTATGAAGAATGTCAACGG - Intronic
928794832 2:35005499-35005521 AATTCTCTGAAGAATGTCAATGG - Intergenic
928831155 2:35485388-35485410 AACGAGATGAAGGATGTGGAAGG + Intergenic
928850430 2:35738868-35738890 AATTCTGTGAAGAATGTCAATGG - Intergenic
928900460 2:36312408-36312430 AATTCTGTGAAGAATGTTAATGG - Intergenic
928960302 2:36918746-36918768 AATGCTATTAAGCATAAGGAGGG - Intronic
929262114 2:39877237-39877259 AATTCTGTGAAGAATGTCAATGG + Intergenic
929312451 2:40441371-40441393 AATTCTATGAAGAAAGTCAATGG - Intronic
929371127 2:41224961-41224983 AATTCTGTGAAGAATGTCAATGG - Intergenic
929401402 2:41586127-41586149 AATTCTGTGAAGAATGTAAATGG - Intergenic
929480460 2:42302488-42302510 AATCACATGAAGAATGTGGTCGG - Intronic
929656589 2:43738799-43738821 AATGTTTTGAAGAATGTCTAAGG - Intronic
929657796 2:43751445-43751467 AATGCTCTGAAGAATGAATATGG + Intronic
929964475 2:46523757-46523779 AATTCTGTGAAGAATGTCAATGG + Intronic
930238723 2:48913353-48913375 GTTGCTTTGAAGAATTTGGAGGG - Intergenic
930292990 2:49519068-49519090 AATTCTATGAAGAAAGTCAATGG - Intergenic
930318302 2:49823870-49823892 AATTCTGTGAAGAATGTCAATGG + Intergenic
930552073 2:52848392-52848414 AATTCTGTGAAGAATGTCAATGG + Intergenic
930845555 2:55899826-55899848 AATGCAATGCAGAATGGGGTAGG + Intronic
930907233 2:56586002-56586024 ATTTCTCTGAAGAATATGGATGG - Intergenic
930951789 2:57151499-57151521 AATTCTGTGAAGAATGTCAATGG - Intergenic
930961116 2:57262935-57262957 AATTCTGTGAAGAATGTCAATGG + Intergenic
930981445 2:57530583-57530605 AATTCTGTGAAGAATGTCAATGG - Intergenic
931447244 2:62336780-62336802 AATGCTATGAAGAATAATGGTGG - Intergenic
931477233 2:62601065-62601087 AATTCTTTGAAGAATGTCAATGG + Intergenic
931560897 2:63559899-63559921 AATTCTGTGAAGAATGTCAATGG - Intronic
931974194 2:67624839-67624861 AATTCTGTGAAGAATGTCAATGG + Intergenic
932013958 2:68005444-68005466 AATTCTGTGAAGAATGTCAATGG - Intergenic
932111076 2:69001154-69001176 AATTCTGTGAAGAATGTCAATGG + Intergenic
932380102 2:71274820-71274842 AATTCTGTGAAGAATGTCAATGG - Intergenic
932508757 2:72263949-72263971 AATGCTATGAAGATTCTGAAAGG + Intronic
932847333 2:75149266-75149288 AATTCTGTGAAGAATGTCAATGG + Intronic
932871023 2:75398183-75398205 AATTCTGTGAAGAATGATGATGG - Intergenic
933150924 2:78914082-78914104 AATACTCTGAGGAATGAGGAAGG - Intergenic
933237302 2:79879344-79879366 AATTCTGTGAAGAATGTCAATGG + Intronic
933404248 2:81838106-81838128 AATTCTGTGAAGAATGTTAAAGG + Intergenic
933512555 2:83259513-83259535 AATTCTATGAAGAATGTCTTTGG - Intergenic
933606011 2:84384495-84384517 AATTCTGTGAAGAATGTCAATGG + Intergenic
934310233 2:91856485-91856507 AATTCTTTGAAGAATGATGATGG - Intergenic
934549461 2:95246972-95246994 AATTCTGTAAAGAATGTTGATGG - Intronic
934622198 2:95819354-95819376 AATTCTGTGAAGAATGTCAATGG + Intergenic
934792659 2:97075311-97075333 AATTCTTTGAAGAATGTCAATGG + Intergenic
934813957 2:97308372-97308394 AATTCTTTGAAGAATGTCAATGG - Intergenic
934823738 2:97400110-97400132 AATTCTTTGAAGAATGTCAATGG + Intergenic
934923275 2:98363177-98363199 AATTCTGTGAAGAATGTCAATGG + Intronic
935063446 2:99628091-99628113 AATTCTTTGAAGAATGTCAATGG + Intronic
935079065 2:99774201-99774223 AATTCTGTGAAGAATGTCAATGG - Intronic
935231384 2:101100478-101100500 AATTCTGTGAAGAATGTCAATGG - Intronic
935436621 2:103042461-103042483 AATTCCATGAAGAATGTTGGCGG - Intergenic
935952246 2:108340812-108340834 AATTCTGTGAAGAATGTCAATGG + Intergenic
936118790 2:109724293-109724315 AATTCTGTGAAGAATGTCAATGG + Intergenic
936172477 2:110188626-110188648 AATTCTGTGAAGAATGTCAATGG - Intronic
936237730 2:110758417-110758439 AATTCTGTGAAGAATGTCAATGG + Intronic
936673808 2:114690608-114690630 AATTCTGTGAAGAATGTAAATGG + Intronic
936838963 2:116746059-116746081 AATGCTATGGAGAGAGAGGATGG + Intergenic
936877569 2:117210385-117210407 AATTCTATGAAGAATGTCAATGG - Intergenic
937148308 2:119666935-119666957 AATTCTGTGAAGAATGTCAATGG - Intergenic
937586586 2:123558860-123558882 AATGCTATAAAAACTCTGGAAGG - Intergenic
937663377 2:124456534-124456556 AATGCTGTGAAGAATGATGGTGG - Intronic
937798573 2:126054505-126054527 AATTCTATGAAGAGTGATGATGG + Intergenic
937918405 2:127112479-127112501 AATGCTAGCAAGGATTTGGATGG - Intergenic
937931977 2:127213283-127213305 AATTCTGTGAAGAATGTCAATGG - Intronic
937945995 2:127337390-127337412 AATGCTATATAGTATCTGGAGGG + Intronic
938567064 2:132528455-132528477 AATTCTGTGAAGAATGTCAATGG + Intronic
938675408 2:133628604-133628626 AATTCTGTGAAGAATGTCAATGG - Intergenic
939110116 2:137996637-137996659 AATTCTGTGAAGAATGTCGATGG - Intronic
939216812 2:139249230-139249252 AATTCTGTGAAGAATGTCAATGG + Intergenic
939288192 2:140159676-140159698 AATTCTGTGAAGAATGTCAATGG + Intergenic
939391557 2:141575071-141575093 AATTCTGTGAAGAATGTCAATGG - Intronic
939975773 2:148715748-148715770 AATTCTGTGAAGAATGTCAATGG + Intronic
940096489 2:149982128-149982150 AATTCTATGAAGAAAGTCAATGG - Intergenic
940402463 2:153263411-153263433 AATTCTGTGAAGAATGTCAATGG - Intergenic
940592985 2:155752832-155752854 AATTCTGTGAAGAATGTCAATGG - Intergenic
940595242 2:155783133-155783155 AGTTCCATGAAGAATGTGGATGG - Intergenic
940745539 2:157563582-157563604 AATTCTGTGAAGAATGTCAATGG - Intronic
940822247 2:158369198-158369220 AATTCTGTGAAGAATGTCAATGG + Intronic
941048547 2:160704521-160704543 AATGCTCTGAAGTATGAGGTAGG - Intergenic
941061030 2:160847344-160847366 AATTCTGTGAAGAATGATGATGG - Intergenic
941234975 2:162960445-162960467 AATTCTGTGAAGAATGTCAATGG - Intergenic
941276382 2:163496026-163496048 AATTCTATGAAGACTGTCAATGG - Intergenic
941360457 2:164545232-164545254 AATGCAATGAAGTTTGTGGCAGG + Intronic
941627814 2:167849196-167849218 AATTCTATGAAGAATGATGGTGG - Intergenic
942372234 2:175297474-175297496 AATTCTGTGAAGAATGTCAATGG - Intergenic
942376080 2:175339502-175339524 AATTCTTTGAAGAATGTCCATGG + Intergenic
942393367 2:175519997-175520019 AATTCTGTGAAGAATGTCAATGG + Intergenic
942729114 2:179044272-179044294 AATACTGTGAAGAATGTCAATGG - Intronic
942743976 2:179211276-179211298 AATTCTGTGAAGAATGATGATGG - Intronic
942984620 2:182124422-182124444 AATTCTATGAAGAAAGTCAATGG + Intronic
943073434 2:183168395-183168417 AATTCTGTGAAGAATGTCAATGG + Intergenic
943158614 2:184217087-184217109 AGTTCTATGAAGAATGTCAATGG + Intergenic
943286926 2:186013388-186013410 AATTCTGTGAAGAATGTCAATGG - Intergenic
943472633 2:188313639-188313661 AATTCTGTGAAGAATGTCAATGG + Intronic
943562431 2:189479815-189479837 AATGAAATGAACAATGAGGAAGG - Intergenic
943714842 2:191139719-191139741 AAATCTATGAAGAATGATGATGG - Intronic
943957366 2:194209353-194209375 AATTCTATGAAGAATGAGAGAGG + Intergenic
944035942 2:195294706-195294728 AATTCTATGAAGAATGTCAATGG - Intergenic
944126727 2:196302441-196302463 AATTCTGTGAAGAATGTCAATGG + Intronic
944364124 2:198896540-198896562 AATTCTGTGAAGAATGTCAATGG - Intergenic
944377821 2:199068572-199068594 AATGCTCTCAAGAATGGGAATGG - Intergenic
944421075 2:199530926-199530948 AATGCTGTGAAGAATGATGGTGG - Intergenic
944456189 2:199897288-199897310 AATAAAATGAAGAATTTGGAAGG - Intergenic
944964997 2:204921182-204921204 AATTCTATTAAAAATGCGGAAGG - Intronic
945286107 2:208083781-208083803 AGTTCTATGAAGAATGATGATGG - Intergenic
945434158 2:209799100-209799122 AATTCTGTGAAGAATGTCAATGG + Intronic
945439339 2:209860573-209860595 AATTCTGTGAAGAATGTCAATGG + Intronic
945480818 2:210343450-210343472 AATTCTGTGAAGAATGATGATGG + Intergenic
945608800 2:211972369-211972391 AATTCTGTGAAGAATGTCAATGG - Intronic
945623030 2:212166552-212166574 AATTCTGTGAAGAATGTCAATGG - Intronic
945750166 2:213771975-213771997 AATTCTGTGAAGAATGTCAATGG + Intronic
945826188 2:214722817-214722839 AATTCTGTGAAGAATGATGATGG - Intergenic
945838695 2:214862757-214862779 AGTTCTATGAAGAATGATGATGG + Intergenic
945847574 2:214964843-214964865 AATTCTGTGAAGAATGTCAATGG - Intronic
946785830 2:223243033-223243055 AATTCTATGAAGAATATCAATGG + Intergenic
946974180 2:225129629-225129651 AATTCTGTGAAGAATGTCAATGG - Intergenic
947479700 2:230487710-230487732 AATTCTGTGAAGAATGTCAATGG + Intronic
947688134 2:232109023-232109045 AATTCTGTGAAGAATGTCAATGG - Intronic
947914894 2:233824849-233824871 AATTCTGTGAAGAATGTCAATGG + Intronic
948745843 2:240093340-240093362 AATTCTGTGAAGAATGTCAATGG + Intergenic
1168933090 20:1640148-1640170 AATTCTGTGAAGAATGTCAATGG + Intronic
1169695262 20:8380472-8380494 AATTCTGTGAAGAATGTCAATGG + Intronic
1169877316 20:10312222-10312244 AATGCTTTGAAGCAGATGGAAGG - Intergenic
1169929866 20:10820926-10820948 AATTCTATGAAGAAAGTCAATGG - Intergenic
1169978723 20:11359774-11359796 AATTCTGTGAAGAATGTCAATGG + Intergenic
1170011863 20:11732653-11732675 AATTCTATGAAGAATGTCAATGG - Intergenic
1170060299 20:12252046-12252068 AATCCTATGAAGAATGTCAGTGG + Intergenic
1170454955 20:16523649-16523671 AATTCTATGAAGAAAGTCAATGG - Intronic
1170492539 20:16893223-16893245 AATTCTATGAAGAATGTCAATGG - Intergenic
1170803479 20:19610168-19610190 AATGATAAGAAGGAAGTGGAAGG - Intronic
1170826843 20:19803722-19803744 AATTCTGTGAAGAATGTCAATGG + Intergenic
1171137954 20:22714393-22714415 AATTCTGTGAAGAATGTTAATGG + Intergenic
1171241927 20:23577048-23577070 AGTTCTATGAAGAATGATGATGG + Intergenic
1171881932 20:30623645-30623667 AATTCTATGAAGAAAGTCAATGG + Intergenic
1171937687 20:31291243-31291265 AATTCTATGAAGAATGTCAATGG - Intergenic
1173047302 20:39525019-39525041 AATGCTTAGAATAATGTGGTGGG - Intergenic
1174952927 20:55063042-55063064 AATTCTGTGAAGAATGTCAATGG + Intergenic
1174991778 20:55518976-55518998 AATTCTGTGAAGAATGTCAACGG + Intergenic
1175159071 20:56994577-56994599 CATGCTGGGAAGAATGTGGAAGG + Intergenic
1175591594 20:60196939-60196961 AATTCTGTGAAGAATGTCAATGG + Intergenic
1176602268 21:8804291-8804313 AATTCTATGAAGAAAGTCAATGG + Intergenic
1176612777 21:9000685-9000707 AATTCTATGAAGAATGTCATTGG - Intergenic
1176892198 21:14331774-14331796 AATTCTATGAAGAAAGTCAATGG - Intergenic
1176987220 21:15451368-15451390 AATTCTGTGAAAAATGTTGATGG + Intergenic
1177099557 21:16883398-16883420 AATTCTGTGAAGAATGTCAATGG - Intergenic
1177118319 21:17111381-17111403 AATTCTGTGAAGAATGTCAATGG - Intergenic
1177241640 21:18465877-18465899 AATTCTGTGAAGAAAGTGAAGGG - Intronic
1177280370 21:18974371-18974393 AATTCTGTGAAGAATGTCAATGG - Intergenic
1177373397 21:20236449-20236471 AATTCTGTGAAGAATGTCAATGG + Intergenic
1177381167 21:20346357-20346379 AATGAAAAGCAGAATGTGGATGG - Intergenic
1178033930 21:28559583-28559605 AATTCTATGAAAAATGTTGATGG - Intergenic
1179074435 21:38106829-38106851 AATGCCATCAAGAAAGTGAAAGG + Intronic
1180047385 21:45315034-45315056 AATTCTGTGAAGAATGTCAATGG - Intergenic
1180344554 22:11695843-11695865 AATTCTATGAAGAAAGTCAATGG + Intergenic
1180536975 22:16402420-16402442 AATTCTCTGAAGAATGATGATGG - Intergenic
1181717460 22:24742361-24742383 AGTTCTATGAAGAATGATGATGG - Intronic
1181743501 22:24939814-24939836 TGTGCCATGAAGAAGGTGGAGGG - Intronic
1181874743 22:25931275-25931297 AATGCTATGATGAATGAAGTGGG + Intronic
1182061497 22:27401453-27401475 AATGCTGGAAGGAATGTGGAAGG - Intergenic
1182099759 22:27649556-27649578 ATTGCGATGAAGAAGGTAGAGGG - Intergenic
1182534824 22:30993041-30993063 GATGTTATGAGGAATTTGGAAGG - Intergenic
1182606290 22:31506974-31506996 AATTCTGTGAAGAATGTCAATGG - Intronic
1182806328 22:33073663-33073685 AAGAATATGAAGAATGTGAATGG - Intergenic
1182952228 22:34387883-34387905 AATTCTGTGAAGAAAGTTGATGG + Intergenic
1182986000 22:34717094-34717116 AATTCTGTGAAGAATGTCGTCGG + Intergenic
1183024796 22:35056993-35057015 AATGCTGTGAAGAATGTCATTGG - Intergenic
1183317489 22:37144786-37144808 AATGCTATGATGAAAATGTAGGG - Intronic
1184602428 22:45551538-45551560 AAAGCCAGGAAGAATATGGAGGG - Intronic
1184809298 22:46818760-46818782 AATTCTGTGAAGAATGTCAATGG + Intronic
1184949026 22:47826742-47826764 AATTCTGTGAAGAATGTCAATGG + Intergenic
949128985 3:478657-478679 AATTCTGTGAAGAATGTTAAAGG - Intergenic
949145566 3:695630-695652 AATGATGTGAAGAATGATGATGG + Intergenic
949758550 3:7442007-7442029 AATTCTGTGAAGAATGTAGTTGG + Intronic
950323292 3:12078829-12078851 AATTCTGTGAAGAATGTCAACGG + Intronic
950561557 3:13731919-13731941 AATTCTGTGAAGAAAGTTGACGG + Intergenic
950733047 3:14979496-14979518 AATGCTATAAAGAAAAGGGAAGG + Intronic
951444030 3:22756105-22756127 AATTCTGTGAAGAATGAGGGTGG - Intergenic
951844338 3:27069499-27069521 AATGCAATGAAGAATGCAAAAGG + Intergenic
951897245 3:27621629-27621651 AATTGTATGAAGAATGTCAATGG + Intergenic
951971979 3:28456009-28456031 AATTCTGTGAAGAATGTCAATGG + Intronic
952009615 3:28885510-28885532 TAGGCTGTTAAGAATGTGGAGGG + Intergenic
952177743 3:30884674-30884696 AATGCAATGTATAATGAGGAAGG - Intronic
952329994 3:32355987-32356009 AATGTTATGAAGAAGGTAAACGG - Intronic
952518231 3:34127469-34127491 AATTCTCTGAAGAATGTCAATGG - Intergenic
952556380 3:34535797-34535819 AATGCTAGGTAGAAGGTTGATGG - Intergenic
952574920 3:34763107-34763129 AATTCTCTGAAGAATGTCAATGG - Intergenic
952616779 3:35282863-35282885 AATTCTGTGAAGAATGTAAATGG - Intergenic
952679095 3:36070554-36070576 AATTCTGTGAAGAATGTCAATGG + Intergenic
952695721 3:36263534-36263556 AATTCTGTGAAGAATGTCAATGG + Intergenic
952721338 3:36536209-36536231 AATTCTGTGAAGAATGTCAATGG - Intronic
953269650 3:41428383-41428405 AATTCTTTGAAGAATGTCAATGG - Intronic
953306295 3:41833057-41833079 AATTCTGTGAAGAATGTCAATGG + Intronic
953374027 3:42413571-42413593 AATGCTATGGAGGATGGGCAAGG + Intergenic
954528836 3:51299938-51299960 AATTCTGTGAAGAATGTCAATGG + Intronic
955121779 3:56067080-56067102 AATTCTGTGAAGAATGTCAATGG + Intronic
955341440 3:58128514-58128536 ACTGCTATGAAGAATGAGAATGG + Intronic
955641092 3:61085245-61085267 AAAGCTATTAGGAATGTGAATGG - Intronic
955723428 3:61907405-61907427 AATGCTGAGAAGAATCAGGAGGG - Intronic
955838363 3:63083799-63083821 AATTCTATGAAGAATGTCATTGG + Intergenic
956303188 3:67794893-67794915 AATTCTGTGAAGAATGTCAATGG + Intergenic
956375179 3:68606663-68606685 AATTCTGTAAAGAATGTGAATGG - Intergenic
957433722 3:80147875-80147897 AATTCTGTGAAGAATGTCAATGG + Intergenic
957629663 3:82702939-82702961 AATTCTGTGAAGAATGTCAATGG + Intergenic
957951506 3:87133096-87133118 AATTCTATGAAGAATGTCATTGG + Intergenic
957967591 3:87342050-87342072 AATTCTATGAAGAATGTCATTGG + Intergenic
957972045 3:87394811-87394833 AATTCTCTGAAGAATGATGATGG - Intergenic
958136555 3:89501922-89501944 AATTCTGTGAAGAATGTCAATGG - Intergenic
958972278 3:100625061-100625083 AATTCTGTGAAGAATGTCAATGG + Intronic
958976369 3:100672081-100672103 AATTCTGTGAAGAATGTCAATGG + Intronic
959030618 3:101295584-101295606 AATTCTGTGAAGAATGTCAATGG + Intronic
959039431 3:101404035-101404057 AATTCTATGAAGAATGTTGTTGG - Intronic
959205420 3:103300710-103300732 AATTCTATGAAGAATGTCAATGG + Intergenic
959274951 3:104266805-104266827 AATTCTATGAAGAATGATGGTGG + Intergenic
959365564 3:105453598-105453620 AATTCTGTGAAGAATGTCAATGG + Intronic
959390897 3:105771990-105772012 AGTTCTGTGAAGAATGTTGATGG - Intronic
959417960 3:106100060-106100082 AATTCTTTGAAGAATGTCAATGG + Intergenic
959694943 3:109239241-109239263 AATTCTGTGAAGAATGTCAATGG - Intergenic
959765629 3:110023974-110023996 AATTCTGTGAAGAATGATGATGG - Intergenic
960265122 3:115612688-115612710 AATTCTATGAGGAATGTCAATGG + Intergenic
960414126 3:117363304-117363326 AATTCTGTGAAGAATGTCAATGG - Intergenic
960523200 3:118679601-118679623 AATTCTGTGAAGAATGTCAATGG + Intergenic
960679689 3:120234551-120234573 AATTCTGTGAAGAATGTCAATGG + Intronic
960681631 3:120253922-120253944 AATTCTGTGAAGAATGTCAATGG - Intronic
961921917 3:130435465-130435487 AATTCTGTGAAGAATGTCAATGG + Intronic
961925913 3:130480448-130480470 AATTCTATGGGGAAAGTGGAAGG + Intronic
961951381 3:130752917-130752939 AATACCATGAAAAATATGGATGG + Intergenic
961963384 3:130876643-130876665 ATTTCTATGAAGAATGTCGTTGG + Intronic
961987796 3:131156425-131156447 AATGCCATTGAGAATGTGGTTGG + Intronic
962401481 3:135063211-135063233 AATTCTGTGAAGAATGTTGGAGG + Intronic
962504467 3:136032029-136032051 AATTCTGTGAAAAATGTTGATGG + Intronic
962696532 3:137953253-137953275 AATTCTGTGAAGAATGTCAATGG + Intergenic
962910454 3:139844202-139844224 AATTCTTTGAAGAATGTCAATGG + Intergenic
962999131 3:140660555-140660577 AATTCTGTGAAGAATGTCAATGG - Intergenic
963013527 3:140798780-140798802 AATTCTGTGAAGAATGTCAATGG + Intergenic
963259926 3:143181772-143181794 AATTCTGTGAAGAATGTCAATGG + Intergenic
963362464 3:144292143-144292165 AATTCTGTGAAGAATGTCAATGG + Intergenic
963383926 3:144567112-144567134 ACTTCTATGAAGAATGATGATGG - Intergenic
963400041 3:144786802-144786824 AATTCTGTGAAGAATGTCAATGG + Intergenic
963460993 3:145615032-145615054 AATTCTGTGAAGAATGTCAATGG + Intergenic
963532450 3:146487787-146487809 AATTCTGTGAAGAATGTCAATGG - Intronic
963587202 3:147207186-147207208 AATTCTGTGAAGAATGTCAAAGG + Intergenic
964007361 3:151847795-151847817 AATTCTGTGAAGAATGTTAAGGG + Intergenic
964070830 3:152631109-152631131 AATTCTATGATGAATGTCAATGG + Intergenic
964168418 3:153737082-153737104 AATTCTGTGAAGAATGTCAATGG - Intergenic
964252821 3:154739389-154739411 AATGCTGTGAAGAATGATGGTGG + Intergenic
964294751 3:155221145-155221167 AATTCTGTGAAGAATGTTAATGG + Intergenic
964498826 3:157325857-157325879 AATTCTGTGAAGAATGTCAATGG + Intronic
964505773 3:157397455-157397477 AATTCTGTGAAGAATGTTAATGG + Intronic
964594776 3:158412956-158412978 AATTCTGTGAAGAATGTCAATGG - Intronic
965159628 3:165115674-165115696 AATTCTGTGAAGAATGTCAATGG + Intergenic
965295218 3:166936767-166936789 AATTCTATGAAGAATGTTGGTGG + Intergenic
965345513 3:167544280-167544302 AATTCTGTGAAGAATGATGATGG - Intronic
965421533 3:168465242-168465264 AATTCTGTGAAGAATGTCAATGG - Intergenic
966329734 3:178797661-178797683 AATTCTGTGAAGAATGTCAATGG + Intronic
966344147 3:178959837-178959859 AATTCTGTGAAGAATGATGATGG + Intergenic
966539225 3:181070849-181070871 AATTCTGTGAAGAATGTCAATGG + Intergenic
966842370 3:184100112-184100134 GATGAGATGAAGAATGGGGAGGG - Intronic
967141873 3:186568352-186568374 AATGCTATGAAAATTGGGGCGGG + Intronic
967187261 3:186955358-186955380 AATTCTGTGAAGAATGTCAATGG + Intronic
967365459 3:188681439-188681461 AATGCTATGAACATTTTGGAGGG - Intronic
967567593 3:190990053-190990075 AATTCCATGAAGAATGTTGTTGG + Intergenic
967593658 3:191306192-191306214 AGTGCTGTGAAGAATGTCAATGG + Intronic
967790383 3:193542438-193542460 AATTCTATGAAGAATGTCAATGG - Intronic
968692649 4:2002347-2002369 AATTCTGTGAAGAATGTCAATGG - Intronic
969137976 4:5045979-5046001 AATTCTGTGAAGAATGTTAATGG - Intergenic
969419123 4:7080836-7080858 AATTCTGTGAAGAATGTCAATGG + Intergenic
969742175 4:9037231-9037253 AATTCTATAAAGAATGATGATGG - Intergenic
970033845 4:11709155-11709177 AATACTGTGAAGAATGTCAAAGG + Intergenic
970411747 4:15815293-15815315 AATTCTATGAAGAAAGTCAATGG + Intronic
970952325 4:21771468-21771490 AATTCTGTGAAGAATGTCAATGG + Intronic
970995361 4:22261299-22261321 AATTCTATGAAGAAAGTCAATGG - Intergenic
971150616 4:24027678-24027700 AATTCAATGAACAATGTGTATGG + Intergenic
971270212 4:25136679-25136701 AATTCTATGAAGAATGTCAACGG - Intronic
971471916 4:27035810-27035832 AGTTCTATGAAGAATGATGATGG + Intergenic
971517056 4:27500419-27500441 AATTCTATGAAGAATGTCAATGG - Intergenic
971772060 4:30909791-30909813 AATGCTGTGAAGAAAGTCAATGG - Intronic
971853461 4:32013360-32013382 AATTCTGTGAAGAATGTTAATGG - Intergenic
971975859 4:33685714-33685736 ACTGCTATGAAGATTATAGAAGG - Intergenic
972190977 4:36590197-36590219 AATTCTATGAAGAATGTCAATGG + Intergenic
972261458 4:37412597-37412619 AATGCTGTGAAGAAAGTCCATGG - Intronic
972283650 4:37627626-37627648 AATGTTATCAAGACTGTGGCAGG - Intronic
972763422 4:42129391-42129413 AATTCTGTGAAGAATGTCAATGG - Intronic
972825600 4:42755653-42755675 AATTCTGTGAAGAATGTCAATGG + Intergenic
973018296 4:45168701-45168723 AATTCTGTGAAGAATGTCAAGGG + Intergenic
973020699 4:45202255-45202277 AAGGCTCTGAACAATGTGTATGG + Intergenic
973179215 4:47247545-47247567 AATTCTATGAAGAATGATGGTGG + Intronic
973210604 4:47611120-47611142 AATTCTGTGAAGAATGTCAATGG + Intronic
973365596 4:49206099-49206121 AATTCTATGAAGAAAGTCAATGG + Intergenic
973394998 4:49586355-49586377 AATTCTATGAAGAAAGTCAATGG - Intergenic
973585790 4:52389707-52389729 AATTCTGTGAAGAATGTCAATGG + Intergenic
973643803 4:52929971-52929993 AATTCTGTGAAGAATGTCAATGG - Intronic
973835002 4:54800795-54800817 AATTCTATGAAGAAAGTCAATGG - Intergenic
974233367 4:59147105-59147127 AATTCTGTGAAGAATGTAAATGG + Intergenic
974339680 4:60599399-60599421 AATTCTGTGAAGAATGTCAATGG + Intergenic
974404334 4:61446504-61446526 TATGATGTGAAGAATTTGGAGGG - Intronic
974597634 4:64035895-64035917 AATTCTGTGAAGAATGTTGATGG - Intergenic
974605023 4:64140952-64140974 AATTCTGTGAAGAATGTCAATGG + Intergenic
974741155 4:66009719-66009741 AATTCTGTGAAGAATGTCAATGG + Intergenic
974769066 4:66387191-66387213 AATTCTGTGAAGAATGTCAATGG - Intergenic
974949368 4:68569730-68569752 ACTGCTATGTAGTATCTGGATGG - Intronic
974968429 4:68794728-68794750 AATTCTACGAAGAATGTCAATGG + Intergenic
975065341 4:70055968-70055990 AATTCTGTGAAGAATGTCAATGG + Intronic
975212538 4:71717953-71717975 AATTCTGTGAAGAATGTCAATGG + Intergenic
975290574 4:72673385-72673407 AATTCTATGAAAAATGTTGTTGG + Intergenic
975453871 4:74565931-74565953 AATTCTGTGAAGAATGTCAATGG - Intergenic
975672967 4:76800495-76800517 ATTTCTATGAAGAATGTCAATGG - Intergenic
975842686 4:78492261-78492283 AATTCTGTGAAGAATGTCAAAGG - Intronic
975998896 4:80347747-80347769 AATTCTGTGAAGAATGTCAATGG - Intronic
976030199 4:80742592-80742614 AGTGCTATGAAGAAAGCTGAGGG + Intronic
976078269 4:81323758-81323780 AATTCTGTGAAGAATGTCAATGG - Intergenic
976093202 4:81478560-81478582 AATTCTATGAAGAAAGTCAATGG - Intronic
976120808 4:81779100-81779122 AATTCTGTGAAGAATGTCAATGG + Intronic
976363570 4:84208212-84208234 AATTCTGTGAAGAAAGTTGATGG - Intergenic
976376033 4:84346051-84346073 AATGCCATGAAGAATGTCAATGG - Intergenic
976450611 4:85186409-85186431 AATTCTATGAAGAATGTCATTGG + Intergenic
976527456 4:86110757-86110779 AATTCTGTGAAGAATGTCAATGG + Intronic
976533917 4:86189269-86189291 AATTCTGTGAAGAATGTCAAAGG + Intronic
976537769 4:86238372-86238394 AATTCTGTGAAGAATGTCAAAGG + Intronic
976722740 4:88185854-88185876 AATGCTGTCAAGAATGTGGAGGG + Intronic
976807001 4:89059288-89059310 AATTCTGTGAAGAATGTCAATGG + Intronic
976994726 4:91416317-91416339 AATTCTGTGAAGAATGTCAATGG - Intronic
977167302 4:93715456-93715478 AATTCTGTGAAGAATGTCAATGG + Intronic
977185243 4:93928444-93928466 AATTCTATGAAGAAAGTCAATGG + Intergenic
977508606 4:97933889-97933911 AATTCTGTGAAGAATGTCAATGG + Intronic
977513919 4:97996052-97996074 AATTCTATGAAGAATGTCATTGG - Intronic
977521543 4:98090581-98090603 AATTCTGTGAAGAATGATGATGG + Intronic
977523896 4:98121413-98121435 AATTCTGTGAAGAATGTCAATGG + Intronic
977669112 4:99675395-99675417 AATTCTGTGAAGAATGTCAATGG - Intergenic
977698827 4:99997974-99997996 AATGCAAGGTAGAATGTGGTAGG - Intergenic
977739814 4:100465705-100465727 ATTACTTTAAAGAATGTGGAGGG + Intronic
977747141 4:100562866-100562888 AATTCCATGAAGAATGGTGATGG - Intronic
978114948 4:105008276-105008298 AATTCTGTGAAGAATGTCAATGG + Intergenic
978657269 4:111079162-111079184 AATTCTGTGAAGAATGTCAATGG - Intergenic
979152555 4:117338603-117338625 AATTCTATGAGGAATGTCAATGG + Intergenic
979272046 4:118774482-118774504 ATTCCTCTGAACAATGTGGATGG - Intronic
979338019 4:119486158-119486180 AATTCTGTGAAGAATGTCGATGG - Intergenic
979373679 4:119919086-119919108 AATTCTGTGAAGAATGTCAATGG - Intergenic
979529458 4:121753656-121753678 AATTCTGTGAAGAATGTCAATGG - Intergenic
979583428 4:122387061-122387083 AATTCTGTGAAGAATGTCAATGG + Intronic
979735457 4:124077214-124077236 AATTCTGTGAAGAATGTCTATGG - Intergenic
979822429 4:125191398-125191420 GATGCTATCAAGAAAATGGATGG + Intergenic
979967491 4:127092764-127092786 AATTCTGTGAAGAATGTCAATGG - Intergenic
979974105 4:127174563-127174585 ACTACTATGAAGAATGTCAAAGG - Intergenic
980021717 4:127718509-127718531 AATTCTATGAAGAATATCAATGG + Exonic
980317222 4:131217958-131217980 AATTCTATGAAGAAAGTAAATGG + Intergenic
980455630 4:133038566-133038588 GATACTAGGAAGGATGTGGAGGG - Intergenic
980524926 4:133977439-133977461 AATTCTGTGAAGAATGTCAATGG + Intergenic
980694973 4:136342661-136342683 AATTCTGTGAAGAATGTTGTTGG - Intergenic
980735445 4:136880400-136880422 GATGCTATCTAGGATGTGGAAGG + Intergenic
980860870 4:138498083-138498105 AATTCTATGAAGAATGAGAGTGG + Intergenic
980887696 4:138781146-138781168 AATTCTATGAAGAAAGTCAATGG + Intergenic
981187434 4:141820298-141820320 AATTCTGTGAAGAATGTCAAGGG - Intergenic
981237781 4:142438167-142438189 AATTCTGTGAAGAATGTCAATGG - Intronic
981257239 4:142676456-142676478 AATTCTGTGAAGAAAGTGAATGG - Intronic
981266461 4:142789703-142789725 AATTCTGTGAAGAATGTTGATGG - Intronic
981290282 4:143067149-143067171 AATTCTGTGAAGAATGTCAATGG + Intergenic
981458226 4:144981178-144981200 AATTCTATAAAGAATGTCAATGG + Intronic
981461778 4:145021142-145021164 AATGCTGTGAAGAATGATGATGG - Intronic
981537521 4:145815133-145815155 AGTGGTATGAAGAAAGTGGGAGG + Intronic
981631464 4:146823626-146823648 AATTCTGTGAAGAATGTCAATGG + Intronic
981662919 4:147188496-147188518 AATTCTGTGAAGAATGTCAATGG - Intergenic
981715164 4:147745309-147745331 AATGTTTTGAAGTATTTGGATGG - Intronic
981721422 4:147805495-147805517 AATTCTATGAAGAATGTCAATGG + Intronic
982452942 4:155573667-155573689 AATTCTGTGAAGAATGTCAATGG - Intergenic
982848664 4:160282191-160282213 AATCTTGTGAAGAATGTCGATGG - Intergenic
982908806 4:161113680-161113702 AATTCTATGAAGAAAGTTAATGG + Intergenic
983135685 4:164076995-164077017 AATTCTATGAAGAAAGTCTATGG - Intronic
983169238 4:164517122-164517144 TATTCTATGAAGAATGTAAATGG + Intergenic
983228226 4:165105069-165105091 AATGCTTTGAAAAACATGGAGGG - Intronic
983276049 4:165619087-165619109 AATTCTGTGAAGAATGTCCATGG - Intergenic
983315697 4:166130312-166130334 AATTCTGTGAAGAATGTCAATGG + Intergenic
983376628 4:166937333-166937355 AAGGCTATGAATGATGTGTAAGG + Intronic
983402701 4:167285487-167285509 AATTCTATGAAGAATGTGAATGG + Intergenic
983685439 4:170402813-170402835 AATTCTATGAAGAATGATGGTGG + Intergenic
983727167 4:170942706-170942728 AATTCTGTGAAGAATGTCAATGG - Intergenic
983821367 4:172197407-172197429 AATTCTGTGAAGAATGTCAATGG - Intronic
984092468 4:175391143-175391165 AATTCTCTGAAGAATGTCAATGG - Intergenic
984482538 4:180324358-180324380 AATTCTGTGAAGAATGTCAATGG + Intergenic
984504706 4:180602518-180602540 AATGTTATAAAGTATGTGAAAGG + Intergenic
984625706 4:182005594-182005616 AATTCTGTGAAGAATGTCAATGG + Intergenic
984790999 4:183614973-183614995 GATGCTTTGAAGATTGAGGAAGG + Intergenic
984854392 4:184181476-184181498 AATTCTGTGAAGAATGTCAATGG - Intronic
984894361 4:184523976-184523998 AATTCTGTGAAGAATGTCAATGG + Intergenic
985213886 4:187628706-187628728 AATGCACTGAAGAGAGTGGAAGG + Intergenic
985278719 4:188266285-188266307 AAAGGAATCAAGAATGTGGAAGG - Intergenic
985393027 4:189511972-189511994 AAAGCCATGAAGAGTCTGGATGG - Intergenic
986183169 5:5412866-5412888 AATTCTGTGAAGAATGTCAATGG - Intergenic
986511508 5:8511604-8511626 AATTCTCTGAAGAATGTCAATGG + Intergenic
986549055 5:8932562-8932584 AATTCTGTGAAGAATGTCAATGG + Intergenic
986956096 5:13151707-13151729 AATTCTATGAAGAATGTCAATGG + Intergenic
987260827 5:16201036-16201058 AATTCTGTGAAGAATGTCAATGG - Intergenic
987399408 5:17459530-17459552 AATTCTGTGAAGAATGTCAATGG + Intergenic
987471335 5:18332485-18332507 AATTCTGTGAAGAATGTCAACGG + Intergenic
987526384 5:19055653-19055675 AATGCTTTGAAGACTAAGGATGG + Intergenic
987540199 5:19245202-19245224 AATTCTGTGAAGAATGTCAATGG - Intergenic
987610180 5:20192876-20192898 AATTCTGTGAAGAATGTCAATGG + Intronic
987669399 5:20987689-20987711 AATTCTGTGAAGAATGTCAATGG + Intergenic
987704091 5:21441696-21441718 AATTCTGTGAAGAATGCTGATGG + Intergenic
987836978 5:23174531-23174553 AATTCTGTGAAGAATGTTAATGG + Intergenic
987852963 5:23381012-23381034 AATTCTGTGAAGAATGTCAATGG - Intergenic
987858948 5:23458789-23458811 AAGGCTATAAAGAATATTGAGGG + Intergenic
987909735 5:24125823-24125845 AATTCTATGAAGAATGTCAATGG + Intronic
987988118 5:25176615-25176637 AATTCTATGAAGAATGTCAATGG + Intergenic
988247930 5:28712928-28712950 CATGCTGGTAAGAATGTGGAAGG + Intergenic
988268650 5:28985406-28985428 AATTCTATGAAAAATGTCAATGG - Intergenic
988962382 5:36383133-36383155 AAAGGTATGAAGCAAGTGGAAGG + Intergenic
989029217 5:37100639-37100661 AATTCTGTGAAGAATGTCAATGG + Intergenic
989183210 5:38598530-38598552 AATGTTAGGTAGAATGTGGCAGG - Intronic
989347794 5:40449454-40449476 AATTCTGTGAAGAATGTCAATGG + Intergenic
989349514 5:40470265-40470287 AATTCTGTGAAGAAAGTGAATGG + Intergenic
990239999 5:53807377-53807399 AATTCTATGAAGAAAGTTGTTGG - Intergenic
990573329 5:57101020-57101042 AATTCTGTGAAGAATGATGATGG - Intergenic
990858686 5:60301239-60301261 AATTCTGTGAAGAATGTCAATGG + Intronic
990904068 5:60784198-60784220 AATGAAATGAAGAAGCTGGAAGG + Intronic
990940323 5:61196393-61196415 AATTCTGTGAAGAATGTCAATGG + Intergenic
991042520 5:62190609-62190631 AATGCTGCAATGAATGTGGAAGG + Intergenic
991150712 5:63365328-63365350 AATTCCATGAAGAATGTCAATGG + Intergenic
991346880 5:65678462-65678484 AATTCTGTGAAGAATGTCAATGG - Intronic
991984918 5:72275495-72275517 AATGCTGTAAAGAATGTCAATGG - Intronic
992337053 5:75782435-75782457 AATTCTATGAAGAAAGTCAATGG - Intergenic
992337810 5:75791251-75791273 AGTTCTGTGAAGAATGTGAATGG + Intergenic
992361733 5:76045438-76045460 AATTCTGTGAAGAATGTCAATGG + Intergenic
992390044 5:76322502-76322524 AATTCTGTGAAGAATGTCAATGG - Intronic
992505542 5:77384008-77384030 AATTCTATGAAGAAAGTCAATGG + Intronic
993230435 5:85228457-85228479 AATTCTGTGAAGAATGTGAGTGG + Intergenic
993253754 5:85560643-85560665 AATTCTGTGAAGAATGTCAATGG - Intergenic
993258767 5:85629548-85629570 AATGCTATGAACATTGTCAATGG + Intergenic
993286678 5:86008128-86008150 AATTCTGTGAAGAATGTCAATGG + Intergenic
993336078 5:86660550-86660572 AATTCTGTGAAGAATGTCAATGG + Intergenic
993420295 5:87693223-87693245 AATTCTGTGAAGAATGTCAATGG + Intergenic
993512996 5:88795169-88795191 AATTCTATGAAGAAAGTCAATGG + Intronic
993621849 5:90177950-90177972 AATTCTGTGAAGAATGTCAATGG - Intergenic
993674380 5:90799544-90799566 AATTCTATGAAGAAAGTCAATGG - Intronic
993708586 5:91199244-91199266 AATTCTGTGAAGAATGTCAATGG - Intergenic
993821193 5:92618991-92619013 AATTCTGTGAAGAATGTCAATGG + Intergenic
993890592 5:93467248-93467270 AATTCTGTGAAGAATGTCAATGG - Intergenic
994222559 5:97212804-97212826 AATTCTGTGAAGAATGTCAATGG + Intergenic
994228515 5:97284136-97284158 AGTTCTATGAAGAATGTCAATGG + Intergenic
994277137 5:97852941-97852963 AGTTCTATGAAGAATGCTGATGG - Intergenic
994550872 5:101233327-101233349 AATACTGTGAAGAATGTCAATGG + Intergenic
994586139 5:101711774-101711796 AATTCTATGAAGAAAGTCGTTGG + Intergenic
994883358 5:105526963-105526985 AATTCTATGAAGAATGATGGTGG + Intergenic
994964567 5:106652594-106652616 AATTCTGTGAAGAAAGTCGATGG + Intergenic
995003430 5:107162403-107162425 AATTCTGTGAAGAATGTCAATGG - Intergenic
995081213 5:108052663-108052685 AATTCTGTGAAGAATGTCAATGG - Intronic
995119907 5:108525044-108525066 AATGCTATGAAGGAAATGCATGG + Intergenic
995157611 5:108933621-108933643 AATTCTATGAAGAAAGTCAATGG + Intronic
995188387 5:109295143-109295165 AATTCTGTGAAGAATGTCAATGG - Intergenic
995263125 5:110128835-110128857 AATTCTATGAAGAAAGTAAATGG + Intergenic
995865422 5:116685245-116685267 AGTCCTATGCAGACTGTGGAGGG + Intergenic
996055452 5:118977798-118977820 AATACTGTGAAGAATGTTAATGG - Intronic
996193889 5:120579765-120579787 AATTCTGTGAAGAATGTCAATGG + Intronic
996229762 5:121047922-121047944 AATTCTGTGAAGAATGTCAATGG - Intergenic
996287315 5:121809570-121809592 AATTCTGTGAAGAATGTCAATGG + Intergenic
996481817 5:123984248-123984270 AATTCTGTGAAGAATGTTAATGG + Intergenic
996526624 5:124487005-124487027 AATTCTGTGAAGAATGTCAATGG + Intergenic
996789042 5:127272453-127272475 AATTCTGTGAAGAATGTCAATGG + Intergenic
996806811 5:127464686-127464708 ACTGCTGTGAAGAATGTCAATGG + Intronic
996828794 5:127716719-127716741 AATCCTATGAAGAAGGAGGTGGG - Intergenic
996894245 5:128460471-128460493 AATTCTGTGAAGAATGTCAATGG - Intronic
996910450 5:128651508-128651530 AATACTATGAAGAAAGTCAATGG + Intronic
996917562 5:128730519-128730541 AATTCTGTGAAGAATGTCAATGG - Intronic
997097855 5:130933665-130933687 AATTCTGTGAAGAATGTCAATGG - Intergenic
997349061 5:133217158-133217180 AAAGCAAAGAAGAATGTGGCAGG + Intronic
997799833 5:136849236-136849258 AATTCTGTGAAGAATGTCAATGG + Intergenic
998277788 5:140774941-140774963 AATTCTGTGAAGAATGTCAATGG + Intergenic
998630578 5:143893551-143893573 AATGATATGAACAATGTTAATGG - Intergenic
998779722 5:145643041-145643063 AATTCTATGAAGAAAGTCAATGG + Intronic
998789298 5:145748590-145748612 AATTCTGTGAAGAATGTCAATGG - Intronic
998976462 5:147654239-147654261 AATTCTGTGAAGAATGTCAATGG + Intronic
999257730 5:150219039-150219061 AGTGCTTTAAAGAATGGGGAAGG - Intronic
999665969 5:153913623-153913645 AATTCTGTGAAGAATGTCAATGG + Intergenic
999834797 5:155358014-155358036 AATTCTGTGAAAAATGTTGATGG - Intergenic
1000234159 5:159342251-159342273 AATGCTATGAAGGAAATGAATGG + Intergenic
1000264898 5:159626376-159626398 AATTCTGTGAAGAATGATGATGG - Intergenic
1000376500 5:160587457-160587479 AATTCTGTGAATAATGTTGATGG + Intronic
1000523841 5:162330950-162330972 AATTCTGTGAAGAATGTCAATGG - Intergenic
1000590858 5:163155792-163155814 AATGATATGAAGAATGGAGAGGG + Intergenic
1000625909 5:163538028-163538050 AATTCTATGAAGAATGTCAATGG + Intergenic
1000661206 5:163940802-163940824 AATTCTATGAAGACTGAGGGAGG + Intergenic
1000757451 5:165179341-165179363 AATTCTATGAAGAATGTTGGTGG + Intergenic
1000798646 5:165696311-165696333 AATCCTGTGAAGAATGTCAATGG - Intergenic
1001190262 5:169623701-169623723 AATTCTGTGAAGAATGTCAATGG + Intergenic
1001343839 5:170872044-170872066 AATTCTGTGAAGAATGTCAATGG + Intronic
1001458250 5:171884566-171884588 AATTCTGTGAAGAATGAGAAAGG + Intronic
1001656317 5:173353575-173353597 AATACCATGAAGAATGGAGATGG - Intergenic
1001738715 5:174031113-174031135 AATTCTGTGAAGAATGTCAATGG + Intergenic
1001839295 5:174860485-174860507 AATTCTGTGAAGAATGTCAATGG + Intergenic
1001864957 5:175095798-175095820 AATTCTGTGAAGAATGTCAATGG + Intergenic
1003249173 6:4410351-4410373 AATGCTGTGAAGAATGTCAATGG - Intergenic
1003686577 6:8310204-8310226 AATTCTGTGAAGAATGTCAATGG + Intergenic
1003700353 6:8457695-8457717 AATTCTATGAAGAATGACGTTGG + Intergenic
1003803226 6:9695164-9695186 AATTCTGTGAAGAATGTAAATGG - Intronic
1003902204 6:10665074-10665096 AATTCTATGAAGAATGTCAATGG + Intergenic
1004103017 6:12634426-12634448 AATTCTGTGAAGAATGTCAATGG + Intergenic
1004408192 6:15354814-15354836 AATGCTGTAAAGAATGTTAAAGG + Intronic
1004833713 6:19506760-19506782 AATTCTCTGAAGAATGTCAATGG + Intergenic
1004949347 6:20651079-20651101 AATTCTATGAAGAATGTCAATGG + Intronic
1005151967 6:22761844-22761866 AATTCTGTGAAGAATGTTAATGG + Intergenic
1005795022 6:29350739-29350761 AATTCTCTGAAGAATGTCAATGG + Intergenic
1006077588 6:31543877-31543899 AGTGCTATGAAGAAAATGCAAGG + Intronic
1006251242 6:32787769-32787791 AATTCTTTGAAGAATGTCAATGG - Intergenic
1008260002 6:49354180-49354202 AATTCTATAAAGAATGTTGTTGG - Intergenic
1008282906 6:49617325-49617347 CATGCTATGAAAAATATGTAGGG - Intronic
1008335753 6:50302716-50302738 AATTCTATGAAGAATGTCATTGG + Intergenic
1008548941 6:52609066-52609088 AATTCTGTGAAGAATGTCAATGG + Intergenic
1008707164 6:54176667-54176689 AATTCTGTGAAGAATGTCAATGG - Intronic
1008801593 6:55375148-55375170 AATTCTGTGAAGAATGTCAATGG + Intronic
1008801860 6:55378244-55378266 CATTCTATGAAGAATTTTGATGG + Intronic
1008819414 6:55612413-55612435 AATTCTGTGAAGAATGTAAATGG - Intergenic
1009214330 6:60901957-60901979 AATTCTGTGAAGAATGTCAATGG - Intergenic
1009279331 6:61726888-61726910 AATTCTGTGAAGAATGTCAATGG - Intronic
1009399132 6:63233308-63233330 AATCCTGTGAAGAATGTAAATGG + Intergenic
1009779549 6:68252430-68252452 AGTTCTATGAAGAATGATGATGG + Intergenic
1009832240 6:68953078-68953100 ATTTCTATGAAGAATTAGGAAGG - Intronic
1009916335 6:70001394-70001416 AATTCTGTGAAGAATGTCAATGG + Intronic
1010101846 6:72119418-72119440 AATTCTGTGAAGAATGATGATGG - Intronic
1010406032 6:75506683-75506705 AATTCTGTGAAGAATGTCAATGG - Intergenic
1010466268 6:76170247-76170269 AATTCTATGAAGAATGTCATTGG - Intergenic
1010493622 6:76504757-76504779 AATTCTGTGAAGAATGTCAATGG + Intergenic
1010501218 6:76602669-76602691 AATTCTGTGAAGAATGTAAATGG - Intergenic
1010776827 6:79896435-79896457 AATGAGATCAAGAATGTGAAAGG - Intergenic
1010896783 6:81374800-81374822 AATTCTGTGAAGAATGTCAATGG - Intergenic
1011070388 6:83375120-83375142 AATTCTGTGAAGAATGTCAATGG + Intronic
1011136815 6:84109197-84109219 AATTCTGTGAAGAATGTCAAAGG + Intergenic
1011341427 6:86319426-86319448 AATGCTGTCAAGGATGTGAAGGG + Intergenic
1011377255 6:86702614-86702636 AATTCTGTGAAGAATGTCAATGG + Intergenic
1011830861 6:91369728-91369750 AATTCTCTGAAGAATGTCAATGG + Intergenic
1011931306 6:92717799-92717821 AATGCCATGATGAATTTGTATGG - Intergenic
1011944556 6:92884709-92884731 AATTCTGTGAAGAATGTCAATGG - Intergenic
1012093285 6:94927402-94927424 AATTCTGTGAAGAATGTCAATGG + Intergenic
1012135949 6:95555981-95556003 AATTCTGTGAAGAATGTCTATGG + Intergenic
1012155120 6:95809858-95809880 AATTCTATGAAGAATGTCATTGG + Intergenic
1012182527 6:96172374-96172396 AATGATATGAAAAATGTATATGG - Intronic
1012188850 6:96256028-96256050 AATGCCATGAAGAATGAGGGTGG - Intergenic
1012232232 6:96773486-96773508 AATTCTATGAAGAATGTCAATGG - Intergenic
1012434411 6:99199914-99199936 AATGCTGTGAAGAATGTCAATGG + Intergenic
1012590672 6:100976296-100976318 AATTCTGTGAAGAATGTCAATGG - Intergenic
1012688717 6:102286882-102286904 AATTCTGTGAAGAATGTCAATGG - Intergenic
1012740769 6:103014041-103014063 AATTCTGTGAAGAATGTCAATGG + Intergenic
1012784205 6:103602513-103602535 AATTCTGTGAAGAATGTCAATGG + Intergenic
1012785407 6:103618837-103618859 AATTCTGTGAAGAATGTCAATGG + Intergenic
1012794183 6:103738854-103738876 AATTCTATGAAGAATGATGGTGG - Intergenic
1012870511 6:104667791-104667813 AATTCTGTGAAGAATGTCAATGG - Intergenic
1012909615 6:105104298-105104320 AATGTTACACAGAATGTGGAAGG - Intronic
1012974701 6:105768018-105768040 AATGGGCTGAAGAATGTGGGAGG - Intergenic
1013402192 6:109809503-109809525 AATGCTTTTAAGAGTGTGAAGGG + Intronic
1013423581 6:109989435-109989457 AATTCTGTGAAGAATGTCAATGG - Intergenic
1013669667 6:112386250-112386272 AATTCTGTGAAGAATGTCCATGG - Intergenic
1013683013 6:112545969-112545991 AATTCTATGAAGAAAGTCAATGG - Intergenic
1013716581 6:112969418-112969440 AGTTCTATGAAGAATGTCAATGG - Intergenic
1013919700 6:115389190-115389212 AATTCTGTGAAGAATGTCAAAGG + Intergenic
1013932395 6:115549630-115549652 AATTCTGTGAAGAATGTCAATGG - Intergenic
1014043306 6:116854177-116854199 AATTCTGTGAAGAATGTCAATGG - Intergenic
1014085212 6:117334461-117334483 AATTCTATGAAGAATGTCAACGG - Intronic
1014113784 6:117650146-117650168 AATTCTGTGAAGAAAGTGAATGG - Intergenic
1014256725 6:119168028-119168050 AATTCTGTGAAGAATGTCAATGG - Intergenic
1014279256 6:119422553-119422575 AATTCTATGAAGAAGGTTAATGG - Intergenic
1014301888 6:119692265-119692287 AATTCCATGAAGAATGTAAATGG + Intergenic
1014327993 6:120023700-120023722 AATTCTATGAAGAATGTCAATGG + Intergenic
1014393163 6:120890542-120890564 AATTCTGTGAAGAATGTCAATGG + Intergenic
1014422753 6:121265526-121265548 AATTCTGTGAAGAATGTCAATGG - Intronic
1014431201 6:121372864-121372886 AATTCTGTGAAGAAAGTGAATGG - Intergenic
1014475023 6:121861567-121861589 AATTCTGTGAAGAATGTCAATGG + Intergenic
1014481690 6:121946828-121946850 AGTTCTGTGAAGAATGTTGATGG + Intergenic
1014561213 6:122892993-122893015 AATGCTATGAAGAAAGTCAATGG + Intergenic
1014585003 6:123187082-123187104 AATTCTATGAAGAAAGTCAATGG - Intergenic
1014732078 6:125044126-125044148 CATGCTATGAAGACTGAGGTAGG - Intronic
1015222520 6:130820878-130820900 AATTCTATGAAGAATGATGGTGG - Intergenic
1015381705 6:132577417-132577439 AATTCTGTGAAGAATGTCAATGG - Intergenic
1015501194 6:133935300-133935322 AATTCTATGAAGAAAGTCAATGG - Intergenic
1015587783 6:134793812-134793834 AATTCTGTGAAGAATGTCAATGG - Intergenic
1015651713 6:135469442-135469464 AATTCTGTGAAGAATGTCAATGG - Intronic
1015719177 6:136223637-136223659 AATTCTGTGAAGAATGTCAATGG - Intergenic
1015738937 6:136432526-136432548 AATTCTAAAAAGAATGTGAAAGG + Intronic
1015763178 6:136686889-136686911 AATTCTGTGAAGAATGTCAATGG - Intronic
1015902295 6:138080554-138080576 AATTCTGTGAAGAATGTTAATGG - Intergenic
1016148138 6:140702063-140702085 AATTCTATGAAGAAGGTCAATGG + Intergenic
1016265557 6:142229048-142229070 AATTCTGTGAAGAATGTCAATGG + Intergenic
1016398287 6:143650305-143650327 AATTCTGTGAAGATTGTCGATGG - Intronic
1016423331 6:143908301-143908323 AATTCTGTGAAGAATGTCAATGG + Intronic
1016554286 6:145318086-145318108 AGTTCTGTGAAGAATGTCGATGG + Intergenic
1016618773 6:146082761-146082783 AATTCTGTGAAGAATGTCAATGG + Intronic
1016847555 6:148583435-148583457 AATTCTGTGAAGAATGTCAATGG + Intergenic
1016867971 6:148787715-148787737 AATTCTGTGAAGAATGTCAATGG + Intronic
1017065086 6:150521049-150521071 AATGGTATTAAGAGTGTGGGTGG + Intergenic
1017197003 6:151712366-151712388 AATTCTATGAAGAAAGTCAATGG + Intronic
1017426445 6:154326680-154326702 AATTCTGTGAAGAATGTCAATGG - Intronic
1017573516 6:155774704-155774726 AATTCTATGAAGAATGTCAATGG + Intergenic
1017818925 6:158035206-158035228 AGTTCTATGAAGAATGTCAATGG + Intronic
1017876284 6:158527309-158527331 AATTCTGTGAAGAATGTCAATGG - Intergenic
1018297983 6:162369806-162369828 AGTGCTATGCAAAATGTAGACGG - Intronic
1018325717 6:162665649-162665671 AATTCTGTGAAGAATGTCAATGG - Intronic
1018348284 6:162926270-162926292 AATACTTTGAAGAATGTCAATGG - Intronic
1018375328 6:163205182-163205204 AATTCTATGAAGAATGTCATTGG - Intronic
1018658180 6:166060530-166060552 AATTATATGAAGAATGTCAATGG + Intergenic
1019906655 7:4070000-4070022 GATGCTAAGAGGACTGTGGATGG - Intronic
1020358006 7:7298670-7298692 AATTCTATGAAGAAAGTCAATGG + Intergenic
1020374819 7:7472639-7472661 AATTCTGTGAAGAATGATGATGG - Intronic
1020413770 7:7922619-7922641 ATTGCTATGCAGATTGTTGATGG + Intronic
1020689271 7:11334588-11334610 AATTCTGTGAAGAATGTCAATGG + Intergenic
1020867474 7:13585462-13585484 AATTCTGTGAAGAATGTCAATGG + Intergenic
1021239938 7:18187964-18187986 AATTCTGTGAAGAATGTCAATGG - Intronic
1021429205 7:20540424-20540446 AATTCTGTGAAGAATGTCAATGG - Intergenic
1021747360 7:23756021-23756043 AATTCTGTGAAGAATGTCAATGG + Intronic
1022542259 7:31148345-31148367 AATTCTGTGAAGAATGTCAATGG - Intergenic
1022686248 7:32599898-32599920 AATTCTTTGAAGAATGTCTATGG - Intergenic
1022764563 7:33396620-33396642 AATTCTGTGAAGAATGTCAATGG - Intronic
1022895043 7:34741436-34741458 AATCCTAGGAAGAATGAGGTTGG - Intronic
1023748550 7:43347017-43347039 AATGCTGTGAAGAATGATGGTGG + Intronic
1024990111 7:55227311-55227333 AATTCTGTGAAGAATGTCAATGG + Intronic
1025001741 7:55321140-55321162 AATTCTGTGAAGAATGTCAATGG - Intergenic
1025862655 7:65346182-65346204 AATTCTGTGAAGAATGTTAATGG + Intergenic
1027526208 7:79271880-79271902 AATCCTTTGAAGACTGTGGTGGG - Intronic
1027563221 7:79758869-79758891 AATTCTGTGAAGAATGTCAATGG + Intergenic
1027815211 7:82959731-82959753 AATCCTGTGAGGAGTGTGGAGGG - Intronic
1028009059 7:85617190-85617212 AATTCTATGAAGAATCTCAATGG - Intergenic
1028028583 7:85879017-85879039 AGTTCTATGAAGAATGATGATGG - Intergenic
1028098102 7:86787050-86787072 GATGCTATGAAGATCCTGGATGG + Exonic
1028098912 7:86796585-86796607 AATTCTGTGAAGAATGTCGATGG + Intronic
1028178272 7:87683150-87683172 AATGCTATGAAGGATGAGAGAGG - Intronic
1028182655 7:87744336-87744358 AATTCTATGAAGAATGGTGGTGG + Intronic
1028300705 7:89196019-89196041 AATTCTGTGAAGAATGTCGATGG - Intronic
1028302020 7:89211869-89211891 AATTCTGTGAAGAATGTCCATGG + Intronic
1028490221 7:91403083-91403105 AGTTCTATGAAGAATGTTGATGG + Intergenic
1028518629 7:91704880-91704902 AATACTCTGAAGAATGTCAATGG - Intronic
1028779117 7:94715635-94715657 AATTCTGTGAAGAATGTCAATGG + Intergenic
1028786376 7:94798989-94799011 AATTCTATGAAGAAAGTCAATGG - Intergenic
1028816114 7:95147021-95147043 AATTCTATGAAGAAAGTCAATGG + Intronic
1028955224 7:96681910-96681932 AATTCTATGAAGAAAGTCAATGG + Intronic
1030258356 7:107536728-107536750 AATTCTGTGAAGAATGTCAATGG - Intronic
1030398417 7:109017507-109017529 AATTCTGTGAAGAATGTCAAGGG + Intergenic
1030732603 7:113007680-113007702 AATTCTGTGAAGAATATCGATGG + Intergenic
1030759782 7:113336308-113336330 AATTCTGTGAAGAATGTCAATGG - Intergenic
1030833693 7:114256911-114256933 AATTCTGTGAAGAATGTCAATGG - Intronic
1030973223 7:116088035-116088057 AGTCCTATAAAGAATGTTGAAGG - Intronic
1031254725 7:119433093-119433115 AATTCTGTGAAGAATGTCAATGG - Intergenic
1031297976 7:120028006-120028028 AATTCTGTGAAGAATGTCAATGG + Intergenic
1031346506 7:120673547-120673569 AATGATATGGAGAAGGAGGATGG - Intronic
1031663982 7:124462241-124462263 AGTTCTATGAAGAATGTTGTTGG + Intergenic
1031804979 7:126296908-126296930 AATTCTGTGAAGAATGTCAATGG - Intergenic
1032116302 7:129120595-129120617 ATTTCTATGAAGAATGTCGTTGG + Intergenic
1032914099 7:136467928-136467950 AATTCTGTGAAGAATGTTAATGG + Intergenic
1032966773 7:137106785-137106807 AATTCTATGAAGAAAGTCAATGG - Intergenic
1033083218 7:138318016-138318038 AATTCTGTGAAGAATGTCAATGG - Intergenic
1033358577 7:140621337-140621359 AATGATTTAAAGTATGTGGAAGG - Intronic
1033562848 7:142549295-142549317 AAGGCTGTGAAGAAACTGGAAGG - Intergenic
1033571419 7:142632529-142632551 AATGCTGTGGAGTATGTGGCAGG + Intergenic
1033572925 7:142651259-142651281 AATTCTGTGAAGAATGTCAATGG - Intergenic
1033786589 7:144738578-144738600 ATTGCTATCAAGAAAGTGAAAGG - Intronic
1034012873 7:147549126-147549148 AATTCTGTGAAGAATGTCAATGG + Intronic
1034742336 7:153488357-153488379 AATTCTGTGAAGAATGTCAATGG + Intergenic
1035426381 7:158778115-158778137 AATGCTATTAAGACTATGGTAGG - Intronic
1035814519 8:2524939-2524961 GATCATATGAAGAATGTGTAAGG - Intergenic
1036543391 8:9741449-9741471 ACTGCTATAAAGACTGTGAAAGG - Intronic
1036957462 8:13203958-13203980 AATGCTATGAAGTCTGTGCATGG - Intronic
1037030258 8:14095628-14095650 AATTCTGTGAAGAATGTCAATGG + Intronic
1037685360 8:21134485-21134507 AATTCTGTGAAGAATGTCAATGG + Intergenic
1038074105 8:24050565-24050587 AATTCTGTGAAGAATGTCAATGG - Intergenic
1038357673 8:26845130-26845152 GATACTATCAAGAATGTGAAAGG + Intronic
1038518641 8:28209660-28209682 AGTTCTATGAAGAATGTCAATGG - Intergenic
1038855399 8:31325602-31325624 AATTCTGTGAAGAATGTGATTGG + Intergenic
1039024986 8:33248599-33248621 AATTCTGTGAAGAATGTCAATGG + Intergenic
1039125147 8:34192770-34192792 AATTCTGTGAAGAATGTCAATGG + Intergenic
1039137597 8:34343089-34343111 AATGCCATTAAGTAGGTGGATGG + Intergenic
1039632379 8:39126195-39126217 AATTCTATGAAGAATGTCAATGG + Intronic
1039636669 8:39174707-39174729 AATTCTGTGAAGAATGTCAATGG + Intronic
1039658607 8:39437615-39437637 AATTCTGTGAAGAATGTAAATGG - Intergenic
1039685511 8:39797573-39797595 AATTCTGTGAAGAATGTCAATGG + Intronic
1040613776 8:49014023-49014045 AATTCTGTGAAGAATGTCAATGG + Intergenic
1040635904 8:49272650-49272672 AATTCTGTGAAGAATGTCAATGG - Intergenic
1040684176 8:49851319-49851341 AATTCTATGAAAAATGTAGTTGG - Intergenic
1040968397 8:53108006-53108028 AATTCTATGAAGAAAGTCAATGG + Intergenic
1041041430 8:53850254-53850276 AATTCTGTGAAGAATGTCAATGG + Intergenic
1041112385 8:54496082-54496104 AATTCTGTGAAGAATGTTGGTGG + Intergenic
1041366337 8:57109491-57109513 AATTCTGTGAAGAATGTCAATGG - Intergenic
1041615712 8:59904113-59904135 AATCCTGTGAAGAATGTCAATGG - Intergenic
1041645618 8:60248776-60248798 AATTCTGTGAAGAATGTCAATGG + Intronic
1041764159 8:61400059-61400081 AATTCTGTGAAGAATGTCAATGG + Intronic
1041938230 8:63358155-63358177 AATGAAAGGAAGACTGTGGAAGG - Intergenic
1041960583 8:63610942-63610964 AGTGCTATGAAGAATGGGTGTGG + Intergenic
1041972198 8:63756600-63756622 AATTCTGTGAAGAATGTCAATGG + Intergenic
1042002598 8:64142675-64142697 AATTCTGTGAAGAATGTCAATGG - Intergenic
1042196479 8:66235246-66235268 AATTCTATGAAGAAAGTCAATGG - Intergenic
1042489972 8:69386029-69386051 AATTCTGTGAAGAATGTCAATGG - Intergenic
1042639373 8:70916363-70916385 AGTGCAATGGAGAATGTGCAGGG - Intergenic
1042712241 8:71731080-71731102 AAGGCTAGGAAAAATGAGGAAGG - Intergenic
1042751882 8:72166219-72166241 AATTCTATGAAGAATGTCATTGG + Intergenic
1042760046 8:72261460-72261482 AATTCTGTGAAGAATGTCAATGG - Intergenic
1042764402 8:72304623-72304645 AATTCTATGAAGAGTGTCGTTGG + Intergenic
1042851418 8:73220056-73220078 AATTCTGTGAAGAATGTCAATGG + Intergenic
1042968894 8:74386710-74386732 AATTCTGTGAAGAAAGTCGATGG + Intronic
1043089340 8:75877543-75877565 AATTCTGTGAAGAATGTTAATGG + Intergenic
1043175724 8:77021391-77021413 AATTCTGTGAAGAATGTCAATGG + Intergenic
1043238339 8:77898767-77898789 AATGCTATGAAGTCTGAGAAAGG - Intergenic
1043312073 8:78873095-78873117 AATGCTGTGAAGAATGTCAATGG + Intergenic
1043496198 8:80803302-80803324 AATTCTGTGAAGAATGTCAATGG - Intronic
1043618805 8:82161973-82161995 AAGGCTATGAAGAATGTTAAAGG - Intergenic
1043754942 8:83991464-83991486 ATTTCTATGAAGAATGTTGTTGG - Intergenic
1043774136 8:84243354-84243376 AATTCTGTGAAGAATGTCAATGG + Intronic
1043792811 8:84494428-84494450 AATTCTGTGAAGAATGTTCATGG + Intronic
1044161963 8:88930434-88930456 AATTCTATGAAGAAAGTCAATGG - Intergenic
1044349982 8:91152653-91152675 AATTCTGTGAAGAATGTCAATGG + Intronic
1044450536 8:92331033-92331055 AATTCTGTGAAGAATGTCAATGG + Intergenic
1044452565 8:92354744-92354766 AATTCTGTGAAGAATGTCAATGG + Intergenic
1044502264 8:92971763-92971785 AATTCTGTGAAGACTGTCGATGG - Intronic
1044554507 8:93548159-93548181 AATTCTGTGAAGAATGTCAATGG - Intergenic
1044876921 8:96678196-96678218 AATTCTGTGAAGAATGATGATGG + Intronic
1045030235 8:98128050-98128072 AATGCTGTGCTGAGTGTGGATGG - Intronic
1045705048 8:104912722-104912744 AATTCTGTGAAGAATGTCAATGG + Intronic
1045732579 8:105259343-105259365 AATTCTGTGAAGAATGTCAATGG + Intronic
1045877939 8:107004334-107004356 AATTCTGTGAAGAATGTCAATGG - Intergenic
1045948538 8:107825630-107825652 AATTCTGTGAAGAATGTCAATGG + Intergenic
1046028084 8:108749177-108749199 AATTCTGTGAAGAATGTCAATGG + Intronic
1046285349 8:112086421-112086443 AATTCTATGAAGAAAGTCAATGG - Intergenic
1046398853 8:113676859-113676881 AATACTGTGAAGAATGTCAATGG - Intergenic
1046410224 8:113832129-113832151 AATTCTATGAATAATGTCAATGG + Intergenic
1046603687 8:116346807-116346829 AATTCTATGAAGAAAGTCAATGG + Intergenic
1046709261 8:117491245-117491267 AATTCCATGAAGAATGTCAATGG - Intergenic
1046712653 8:117528766-117528788 AATGCAATGAAAACTGTGGTGGG + Exonic
1046778724 8:118192385-118192407 AAGGTTATAAACAATGTGGAAGG + Intronic
1046786179 8:118269169-118269191 AAAGCAAAGAAGAATGTGAAAGG - Intronic
1046801748 8:118436275-118436297 AATGGGATGATGAATGTGAAGGG - Intronic
1046865182 8:119141079-119141101 AATTCTGTGAAGAATGTTAATGG + Intergenic
1046987271 8:120402116-120402138 AATTCTGTGAAGAATGTCAATGG - Intronic
1047164742 8:122425025-122425047 AATTCTGTGAAGAATGTCGTTGG + Intergenic
1047226967 8:122963648-122963670 AGTTCTATGAAGAATGATGATGG + Intronic
1047332123 8:123900020-123900042 AATGCTGTGAAGAATGATGGTGG + Intronic
1047557988 8:125954032-125954054 AATTCTTTGAAGAATGTCAATGG - Intergenic
1048040623 8:130724428-130724450 AATTCTGTGAAGAATGTCAATGG + Intergenic
1048163494 8:132041606-132041628 AATGGTATGAAGTGTGTGGCTGG - Exonic
1048651809 8:136486219-136486241 AATGCTTTGAGGAAGGTGGGTGG + Intergenic
1048690910 8:136962184-136962206 AATTCTGTGAAGAATGTCAATGG + Intergenic
1048703830 8:137126735-137126757 AATTCTGTGAAGAATGTCAATGG + Intergenic
1050212475 9:3277435-3277457 AAGCCTATGCAGAAAGTGGATGG - Exonic
1050393558 9:5171950-5171972 AGTTCTGTGAAGAATGTCGATGG - Intronic
1050414838 9:5405223-5405245 AATTCTGTGAAGAATGTCAATGG - Intronic
1050675464 9:8047751-8047773 AATTCTGTGAAGAATGATGATGG - Intergenic
1050751085 9:8938168-8938190 GATGCTGTGAAGTATGTGGATGG + Intronic
1050986976 9:12094721-12094743 ATTTCTATGAAGAATATGGAAGG - Intergenic
1051320009 9:15892901-15892923 AATTCTGTGAAGAATGTCAATGG - Intronic
1051703617 9:19852845-19852867 AATTCTGTGAAGAATGTCAATGG + Intergenic
1051836603 9:21345424-21345446 AATTCTGTGAAGAATGTCAATGG - Intergenic
1051914295 9:22189552-22189574 AATTCTATGAAGAATGTCAGTGG - Intergenic
1051946539 9:22576051-22576073 AATTCTGTGAAGAATGTCAATGG - Intergenic
1052200156 9:25768488-25768510 AATTCTTTGAAGAATGTCTATGG - Intergenic
1052224876 9:26073645-26073667 AATTCTTTGAAGAATGTCAATGG + Intergenic
1052369706 9:27650080-27650102 AATTCTGTGAAGAATGTCAATGG - Intergenic
1052385017 9:27812344-27812366 AATTCTGTGAAGAATGTCAATGG - Intergenic
1052416244 9:28181928-28181950 AATTCTGTGAAGAATGTCAATGG - Intronic
1052421253 9:28245908-28245930 AATTCTGTGAAGAATGTTAATGG - Intronic
1052547074 9:29893208-29893230 AATCCTGTGAAGAATGTCAATGG - Intergenic
1052695866 9:31877047-31877069 AATTCTGTGAAGAATGTCAATGG + Intergenic
1052707071 9:32007057-32007079 AATTCTGTGAAGAATGTCAATGG + Intergenic
1053490167 9:38493669-38493691 AATCCTATGAAGAATTTTAATGG - Intergenic
1055133500 9:72802847-72802869 AATTCTGTGAAGAATGTCAATGG - Intronic
1055193902 9:73563179-73563201 AATTCTGTGAAGAATGTCAATGG - Intergenic
1055497606 9:76871279-76871301 AATGCTATGTAAATTGTTGAAGG - Intronic
1055543945 9:77347210-77347232 AGTTCTGTGAAGAATGTTGATGG + Intronic
1055566703 9:77576629-77576651 AATGATGTAAGGAATGTGGAGGG - Intronic
1056096142 9:83255987-83256009 AATTCTGTGAAGAATCTGAATGG - Intronic
1056675192 9:88670374-88670396 AATTCTGTGAAGAATGTCAATGG + Intergenic
1056714462 9:89017113-89017135 AATTCTATGAAGAAAGTCAATGG - Intronic
1056885502 9:90439638-90439660 AATTCTGTGAAGAATGTTGATGG + Intergenic
1057053466 9:91943448-91943470 AAGGCAAGGAAGAATCTGGAGGG - Intronic
1057065142 9:92042648-92042670 AATTTTCTGATGAATGTGGAGGG - Intronic
1057290700 9:93805096-93805118 AATTCTGTGAAGAATGTCAATGG - Intergenic
1057670494 9:97082960-97082982 AATTCTATGAAGAATTTCAATGG - Intergenic
1057712204 9:97456290-97456312 AATTCTGTGAAGAATGTCAATGG - Intronic
1057926058 9:99150871-99150893 AATGCTATGAAGTCTCTGCAGGG + Exonic
1058106275 9:100975662-100975684 GATGCTATGGAGAAAGTGAAGGG + Intergenic
1058167717 9:101638990-101639012 AATGAGATGACGAATGTGGAGGG - Intronic
1058184467 9:101838400-101838422 AATTCTGTGAAGAATGTCAATGG - Intergenic
1058208115 9:102133397-102133419 AATTCTGTGAAGAATGTCAATGG - Intergenic
1058386155 9:104438366-104438388 AATTCTGTGAAGAATGTCAATGG + Intergenic
1058461154 9:105184253-105184275 AATTCTATGAAGAATGTCATTGG + Intergenic
1058517544 9:105791807-105791829 AATGCTGTGAAAAATGTTGTTGG + Intergenic
1058591494 9:106570099-106570121 AATTCTGTGAAGAATGTCTATGG - Intergenic
1058983724 9:110193146-110193168 AAGTTTGTGAAGAATGTGGAGGG + Intronic
1059262297 9:112989645-112989667 AATTCTGTGAAGAATGTCAATGG + Intergenic
1059596695 9:115728423-115728445 AATTCTGTGAAGAATGTCAATGG - Intergenic
1059670380 9:116485414-116485436 AATTCTGTGAAGAAAGTGAATGG - Intronic
1059708507 9:116845755-116845777 AATCCTATCAAGAGTGTGCAAGG - Intronic
1059745782 9:117199654-117199676 AATTCTGTGAAGAATGTCAATGG + Intronic
1059895539 9:118860227-118860249 AATTCTGTGAAGAATGTGCATGG - Intergenic
1060415758 9:123429006-123429028 AATGCTGTGAAGAATGTCAATGG - Intronic
1060453124 9:123762473-123762495 AATGGTATGAAGCATGAGGATGG + Intronic
1060567844 9:124609634-124609656 AATTCTTTGAAGAATGTCAATGG + Intronic
1060739170 9:126086623-126086645 GATGCTATGAAGTAGGGGGAGGG + Intergenic
1061777406 9:132974658-132974680 AATGCTAAGAAGAAAGGGGTGGG + Intronic
1186010209 X:5122779-5122801 AATTCTGTGAAGAATGTCAATGG - Intergenic
1186061598 X:5714106-5714128 AATTCTATGAAGAAAGTCAATGG - Intergenic
1186379502 X:9043066-9043088 AATTCTATGAAGAATGTCAATGG - Intronic
1186431338 X:9507557-9507579 AATTCTGTGAAGAATGTCAATGG - Intronic
1186740583 X:12513742-12513764 AATTCTGTGAAGAATGTCAATGG + Intronic
1186749976 X:12611272-12611294 AATCCTATGAAGAAAGGGCATGG - Intronic
1186859402 X:13656498-13656520 AATCCTGTTAAAAATGTGGAAGG + Intronic
1186874790 X:13806428-13806450 GATCCTATAAAGAATATGGAGGG - Intronic
1186952708 X:14645016-14645038 AATGTGAAGAAGAATTTGGATGG + Intronic
1186990942 X:15066966-15066988 AATTCTGTGAAGAATGTCAATGG - Intergenic
1187015238 X:15320610-15320632 TATGCACTGAAAAATGTGGAGGG + Exonic
1187108863 X:16274789-16274811 AATTCTTTGAAGAATGATGATGG + Intergenic
1187198025 X:17106757-17106779 AATTCTGTGAAGAATGTCAATGG - Intronic
1187584531 X:20645488-20645510 AATTCTGTGAAGAATGTCAATGG - Intergenic
1187762829 X:22606732-22606754 AATTCTGTGAAGAATGTCAATGG - Intergenic
1188730138 X:33635763-33635785 AATTCTATGAAGAAAGTAAATGG + Intergenic
1188757697 X:33984558-33984580 AATGCTAGGAGGAAAGTGTATGG - Intergenic
1188814410 X:34693858-34693880 AATTCTGTGAAGAATGTCAACGG + Intergenic
1188826943 X:34846823-34846845 AATTCTGTGAAGAATGTCAATGG - Intergenic
1188860846 X:35253539-35253561 AATTCTATGAAGATTGTCAATGG - Intergenic
1189030348 X:37443025-37443047 GCTGCTTTGAAGAATGTAGAGGG + Intronic
1189035948 X:37493483-37493505 TCTGCTCTGAAGAATGTAGAGGG + Intronic
1189037468 X:37507033-37507055 ACTGCTTTGAAGAATGTAGAGGG + Intronic
1189107493 X:38252454-38252476 AATTCTGTGAAGAATGTCAATGG + Intronic
1189223357 X:39391817-39391839 AATGCTAAGGGGAATGTGGGTGG + Intergenic
1189243810 X:39547034-39547056 AATGCTGTGAAGAAAGTGAATGG - Intergenic
1189425847 X:40899122-40899144 AATGATATGAAGCATGAGAAAGG + Intergenic
1189651938 X:43199327-43199349 AATTCTGTGAAGAATGTTGATGG + Intergenic
1189855404 X:45219322-45219344 AATTCTGTGAAGAATGTCAATGG - Intergenic
1190530094 X:51366273-51366295 AATCCTGTGAAGAATGTCAATGG - Intergenic
1190550970 X:51580267-51580289 AATTCTGTGAAGAATGTCAATGG - Intergenic
1190567965 X:51750468-51750490 CATGCATTGAAGAATGTGGTTGG - Intergenic
1190590021 X:51990583-51990605 AATTCTTTGAAGAATGTCAATGG + Intergenic
1190901742 X:54681444-54681466 AATTCTGTGAAGAATGTCAATGG - Intergenic
1190992947 X:55571134-55571156 AATTCTGTGAAGAATGTCAATGG - Intergenic
1191005505 X:55707045-55707067 AATTCTGTGAAGAATGTCGTTGG - Intergenic
1191023012 X:55882925-55882947 AATCCTGTGAAGAATGTCAATGG - Intergenic
1191150593 X:57217806-57217828 AATGCTGTGAAGAATGATGGTGG + Intergenic
1191195865 X:57721962-57721984 AATTCTGTGAAGAATGTCAATGG + Intergenic
1191588698 X:62857397-62857419 AATTCTATGAAGAAAGTCAATGG - Intergenic
1191766175 X:64700745-64700767 AATTCTATGAAGAATGTCAGTGG + Intergenic
1191768465 X:64728797-64728819 AATTCTGTGAAGAATGTCAATGG + Intergenic
1191815243 X:65237072-65237094 AATTCTGTGAAGAATGTCAATGG + Intergenic
1191816066 X:65246376-65246398 AGTGCTGTGAAGAATGTCAATGG - Intergenic
1191933461 X:66400273-66400295 AATTCTGTGAAGAATGTCAATGG + Intergenic
1192026747 X:67461062-67461084 AATTCTGTGAAGAATGTCAATGG - Intergenic
1192702796 X:73493570-73493592 AATTCTATGAAGAAAGTCAATGG + Intergenic
1192716840 X:73651854-73651876 AATTCTGTGAAGAATGTCAATGG - Intronic
1192726801 X:73762493-73762515 AATTCTGTGAAGAATGTCAATGG + Intergenic
1192741473 X:73897300-73897322 AATTCTGTGAAGAATGTCAATGG - Intergenic
1193039751 X:76992217-76992239 AATTCTGTGAAGAATGTCAATGG - Intergenic
1193068982 X:77287440-77287462 AATTCTGTGAAGAATGTCAATGG - Intergenic
1193119654 X:77809952-77809974 AATTCTGTGAAGAATGATGATGG + Intergenic
1193176261 X:78398291-78398313 AATTCTGTGAAGAATGTCGTTGG - Intergenic
1193243406 X:79199828-79199850 AATTCTGTGAAGAATGTCAATGG - Intergenic
1193423406 X:81311924-81311946 AATTCTGTGAAGAATGAGGGTGG + Intergenic
1193438326 X:81508289-81508311 AATTCTGTGAAGAAAGTCGATGG + Intergenic
1193452935 X:81692988-81693010 AATTCTCTGAAGAATGTCAATGG + Intergenic
1193500714 X:82270976-82270998 AATTCTGTGAAGAATGTCAATGG + Intergenic
1193589295 X:83367612-83367634 CATTCTATGAAGAATGTCAATGG + Intergenic
1193615182 X:83678813-83678835 AATTCTATGAAGACTGGGAAAGG - Intergenic
1193631328 X:83891979-83892001 AATTCTATGAAGAATGTAATTGG + Intergenic
1193637667 X:83972425-83972447 AATTCTGTGAAGAATGTCAATGG - Intergenic
1193647253 X:84084734-84084756 AATTCTGTGAAGAATGTCAATGG + Intronic
1193664258 X:84296901-84296923 AATTCTGTGAAGAATGTCAATGG - Intergenic
1193685856 X:84576158-84576180 AATTCTATGAAGAAAGTCAATGG - Intergenic
1193895064 X:87103355-87103377 AAAACTATGCAGAATGTAGAAGG - Intergenic
1193910751 X:87303350-87303372 AATTCTGTGAAGAATGTCAATGG + Intergenic
1194016620 X:88629280-88629302 AATTCTGTGAAGAATGTCAATGG - Intergenic
1194022053 X:88702962-88702984 AATTCTAGGAAGAATGTCAATGG - Intergenic
1194170320 X:90573082-90573104 AATTCTGTGAAGAATGTCAATGG - Intergenic
1194191672 X:90844299-90844321 AATTCTGTGAAGAATGATGATGG + Intergenic
1194221159 X:91193181-91193203 AATTCTATGAAGAATGTCAATGG - Intergenic
1194263614 X:91729327-91729349 AATTCTGTGAAGAATGTCAATGG + Intergenic
1194329736 X:92567151-92567173 AATTCTGTGAAGAATGTCAATGG + Intronic
1194383316 X:93222384-93222406 ATTGCCAAGAGGAATGTGGAAGG - Intergenic
1194404317 X:93476083-93476105 AATTCTGTGAAGAATGTCAATGG - Intergenic
1194420327 X:93665071-93665093 AATTCTATGAAGAAAGTCAATGG - Intergenic
1194520396 X:94911073-94911095 AATTCTATGAAGAATGTTATTGG - Intergenic
1194587422 X:95753096-95753118 AATTCTGTGAAGAATGTCAATGG + Intergenic
1194587818 X:95758255-95758277 AATTCTATGAAGAATGATGATGG + Intergenic
1194597125 X:95872231-95872253 AATTCTGTGAAGAATGTCAATGG - Intergenic
1194606251 X:95982346-95982368 AATTCTGTGAAGAATGATGATGG + Intergenic
1194706449 X:97181030-97181052 AATTCTATGAAGAATGTCAATGG + Intronic
1194805422 X:98321056-98321078 AATTCTGTGAAGAATGTCAATGG + Intergenic
1194855713 X:98926099-98926121 AATTCTGTGAAGAATGTCAATGG - Intergenic
1194902383 X:99528931-99528953 AATTCTGTGAAGAATGTCCATGG - Intergenic
1195057939 X:101164694-101164716 AATGCTATAAAGAAAGGGCAGGG + Intergenic
1195148223 X:102039814-102039836 AATTCTGTGAAGAATGTCAATGG - Intergenic
1195149484 X:102051409-102051431 AATTCTGTGAAGAATGTCAATGG + Intergenic
1195198662 X:102524570-102524592 AATTCTGTGAAGAATGTCAATGG - Intergenic
1195305786 X:103582372-103582394 AATTCTGTGAAGAATGTCAATGG - Intronic
1195507494 X:105674685-105674707 AATTCTGTGAAGAATGTCAATGG + Intronic
1195556868 X:106236710-106236732 AATTCTGTGAAGAATGATGATGG - Intergenic
1195759884 X:108234950-108234972 GATGCTATGGAGGATGTGGCAGG + Intronic
1195813164 X:108856435-108856457 AATTCTGTGAAGAATGTCAATGG - Intergenic
1195825891 X:109000275-109000297 AATGTTGTGAAGAATGTCAATGG + Intergenic
1195845626 X:109224792-109224814 AATTCTGTGAAGAATGTCTATGG - Intergenic
1195986007 X:110630922-110630944 AATGCTGTGAAGAAAGTCAATGG - Intergenic
1196054931 X:111344857-111344879 AATTCTGTGAAGAATGTCAATGG - Intronic
1196146584 X:112325265-112325287 AATTCTATGAAGAATGTCATTGG - Intergenic
1196184117 X:112727052-112727074 AATGCTTTGAAGACTGAGGTGGG + Intergenic
1196225452 X:113160425-113160447 AATTCTGTGAAGAATGTCAATGG + Intergenic
1196242696 X:113361894-113361916 AATTCTGTGAAGAATGTCAATGG + Intergenic
1196332428 X:114487844-114487866 AATTCTGTGAAGAATGTCAATGG + Intergenic
1196531937 X:116798240-116798262 AATTCTGTGAAGAATGTCAATGG + Intergenic
1196537509 X:116864822-116864844 AATTCTATGAAGAATGTCAATGG + Intergenic
1196846876 X:119903371-119903393 TATGCTGTTAAGATTGTGGAAGG + Exonic
1196927831 X:120651249-120651271 AATGCTGTGAAGAAAGTCAATGG - Intergenic
1196985844 X:121269763-121269785 AACTCTATGAAGAATGTCAATGG - Intergenic
1197007688 X:121522473-121522495 AATTCTATGAAGAATGTCAATGG - Intergenic
1197029688 X:121798663-121798685 AATTCTTTGAAGAATGTCAATGG + Intergenic
1197107639 X:122734671-122734693 AATTCTGTGAAGAATGTCAATGG - Intergenic
1197115091 X:122822448-122822470 AATTCTGTGAAGAATGTCAATGG - Intergenic
1197123873 X:122921915-122921937 AATTCTGTGAAGAATGTAAATGG + Intergenic
1197180486 X:123530545-123530567 AATTCTGTGAAGAATGTCAAGGG + Intergenic
1197302563 X:124799218-124799240 AATTCTGTGAAGAATGTCAATGG + Intronic
1197319529 X:125010493-125010515 AATTCTGTGAAGAATGTCAATGG - Intergenic
1197349415 X:125364843-125364865 AATTCTGTGAAGAATGTCAATGG + Intergenic
1197359493 X:125482466-125482488 AAAGATAGGAAGCATGTGGATGG + Intergenic
1197456058 X:126676712-126676734 AATTCTGTGAAGAATGTTAATGG - Intergenic
1197490497 X:127110774-127110796 AATTCTGTGAAGAATGTCAATGG - Intergenic
1197548289 X:127855371-127855393 AATTCTGTGAAGAATGTCAATGG + Intergenic
1197571144 X:128152252-128152274 AATTCTATGAAGAATGTCAGTGG - Intergenic
1197601693 X:128538823-128538845 AATTCTGTGAAGAATGTCAATGG + Intergenic
1197609030 X:128617585-128617607 ATTTCTATGAAGAATGTTGAAGG - Intergenic
1198018325 X:132633910-132633932 AATGGTGTCAAGAATGAGGAAGG - Intronic
1198035238 X:132795348-132795370 AATGGTAAGAAGAATGCAGAGGG - Intronic
1198560475 X:137844643-137844665 AATTCTGTGAAGAATGTCAATGG + Intergenic
1198690119 X:139273515-139273537 AATGCTGCAAAGAATGTGGGAGG - Intergenic
1198785784 X:140286251-140286273 AATTCTGTGAAGAATGTCAATGG + Intergenic
1198790041 X:140335203-140335225 AATTCTGTGAAGAATGTCAATGG - Intergenic
1198886880 X:141348826-141348848 AATTCTGTGAAGAATGTCAATGG - Intergenic
1198888897 X:141370238-141370260 AATTCTGTGAAGAATGTCAATGG - Intergenic
1198958088 X:142154245-142154267 AATTCTATGAAGAATGTCAGTGG + Intergenic
1198962151 X:142194452-142194474 GATGCTTTGAAAGATGTGGAAGG - Intergenic
1199079915 X:143565537-143565559 CATGCTATGAAAAATGTCAATGG - Intergenic
1199098966 X:143775821-143775843 AATTCTATGAAGAATGATGCTGG + Intergenic
1199224142 X:145353063-145353085 AATGCTGTGAAGAATGTCAATGG - Intergenic
1199239364 X:145528327-145528349 AATTCTGTGAAGAATGTCAATGG + Intergenic
1199283721 X:146033180-146033202 AGTTCTATGAAGAATGATGATGG - Intergenic
1199401882 X:147407992-147408014 AATTCTGTGAAGAATGTCAATGG - Intergenic
1199588923 X:149447650-149447672 AATTCTATGAAGAATATCAATGG + Intergenic
1199791500 X:151159813-151159835 AATTCTGTGAAGAATGTCTATGG + Intergenic
1199918893 X:152375097-152375119 GATTCTGTGAAGAATGTCGATGG - Intronic
1200530089 Y:4323793-4323815 AATTCTGTGAAGAATGTCAATGG - Intergenic
1200557664 Y:4656936-4656958 AATTCTATGAAGAATGTCAGTGG - Intergenic
1200638438 Y:5686337-5686359 AATTCTGTGAAGAATGTCAATGG + Intronic
1201350683 Y:13037666-13037688 AATTCTATGAAGAAAGTCGTTGG - Intergenic
1201513241 Y:14788506-14788528 TGTGCTTTGAAGAATGAGGAAGG - Intronic
1201669532 Y:16502686-16502708 AATTCTATGAATAATGTTAATGG + Intergenic
1201929318 Y:19324069-19324091 AATTCTTTGAAGAATGTCAATGG - Intergenic