ID: 1132037164

View in Genome Browser
Species Human (GRCh38)
Location 15:98494045-98494067
Sequence CAATGGCAACTGACTTAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132037161_1132037164 -3 Left 1132037161 15:98494025-98494047 CCGAGGGATGAGGGAGTCTCCAA 0: 1
1: 0
2: 0
3: 19
4: 147
Right 1132037164 15:98494045-98494067 CAATGGCAACTGACTTAACCAGG 0: 1
1: 0
2: 0
3: 9
4: 127
1132037155_1132037164 24 Left 1132037155 15:98493998-98494020 CCAGAAGGGAGAAGAAGGTCATT 0: 1
1: 0
2: 1
3: 28
4: 238
Right 1132037164 15:98494045-98494067 CAATGGCAACTGACTTAACCAGG 0: 1
1: 0
2: 0
3: 9
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132037164 Original CRISPR CAATGGCAACTGACTTAACC AGG Intronic
901663197 1:10811848-10811870 CTTAGGCAAGTGACTTAACCAGG + Intergenic
907519599 1:55014482-55014504 CAATGATAACTGACTTTACTGGG - Intergenic
907933845 1:59024665-59024687 AATTGGCAACTAATTTAACCTGG - Intergenic
908759014 1:67494962-67494984 CAATGGCAGCTGCCTGATCCTGG + Intergenic
910823392 1:91376603-91376625 AAAAGGCAAATGACATAACCTGG + Intronic
911276524 1:95866647-95866669 CTTTGGCAAGTTACTTAACCAGG - Intergenic
912704558 1:111902327-111902349 CAGTGGCAACTGAATGAGCCTGG + Intronic
913137441 1:115906253-115906275 CAATGGCACCTGGCTAAACAAGG - Intergenic
914909710 1:151774890-151774912 CAAATGCAACTGCCTTAACCAGG - Intronic
915526097 1:156477131-156477153 CAATGGCAACAGCCTAAACAAGG - Exonic
915792139 1:158684270-158684292 GAATAGCAATTGAGTTAACCAGG + Intronic
916845446 1:168645413-168645435 CCATGCCAACTGACTTCAGCTGG + Intergenic
917059035 1:171017229-171017251 CACTGGCAACTGAGGTATCCAGG + Intronic
920074506 1:203326704-203326726 CAATGGAAACTGAGATAAACAGG + Intergenic
920605133 1:207375073-207375095 CCATGGGAACTGAGTAAACCTGG + Intergenic
1065138183 10:22693206-22693228 CAATGTCAATTTCCTTAACCAGG + Intronic
1070688331 10:78506651-78506673 CCATGGCCACTCACCTAACCAGG + Intergenic
1074453047 10:113575055-113575077 CAATGCCATGTGACTAAACCAGG + Intronic
1074602011 10:114924114-114924136 AAATGGCAACTCACTAAACTGGG - Intergenic
1075052115 10:119190225-119190247 CTGTGGCAACTGACTTCCCCTGG + Intergenic
1082863403 11:57876140-57876162 CAATGAGAAGTGACTTACCCAGG + Intergenic
1088555731 11:111058842-111058864 AAATTGCAACTGACTTGACAGGG + Intergenic
1090106849 11:123862503-123862525 CAATGGTAACTGAATTCACCCGG - Intergenic
1091099372 11:132856254-132856276 AAATGGGAACTGATTTAACCTGG + Intronic
1091541416 12:1465944-1465966 CAGTGGCAACAGAATTAGCCTGG - Intronic
1092201247 12:6585087-6585109 CAATGCCAACTGAAAGAACCCGG + Intronic
1098381896 12:69878829-69878851 CAAAGCCCACTCACTTAACCAGG + Intronic
1100940982 12:99722809-99722831 CACTGGCAACTGAGGTATCCAGG + Intronic
1101187318 12:102292609-102292631 CACTGACAACTGACGTATCCAGG - Intergenic
1101250099 12:102924895-102924917 CATTGGCAAATGAGTAAACCAGG - Intronic
1106700179 13:32220844-32220866 ATTTGGCAACTGACTTATCCTGG + Intronic
1107421161 13:40248196-40248218 CAATAAGAACTGACCTAACCAGG + Intergenic
1107496329 13:40929069-40929091 CAATGGCCAATGATTTAATCAGG + Intergenic
1110217574 13:73039957-73039979 CAGTGACAAGTGAATTAACCAGG - Intergenic
1111518156 13:89362744-89362766 CAATTGCAACTCCCTGAACCTGG + Intergenic
1111578829 13:90195995-90196017 TAATGGGAACTGACATAAACAGG + Intergenic
1111828140 13:93294948-93294970 CAACCTGAACTGACTTAACCAGG - Intronic
1112863772 13:103868706-103868728 AAAAGAAAACTGACTTAACCTGG + Intergenic
1116428562 14:44820101-44820123 CACTGGCAACTGAGGTATCCAGG + Intergenic
1116677170 14:47920429-47920451 CACTGGCAACTGAGGTATCCAGG - Intergenic
1119455017 14:74747450-74747472 AAATGGAAACTGACTTGGCCTGG + Intergenic
1120859076 14:89238248-89238270 CAATGGTAACTGTGTTTACCCGG + Intronic
1124376415 15:29131931-29131953 GAATGGCATCTGACCTAAGCCGG + Intronic
1127034482 15:54900093-54900115 CAATGTCACCTGAGGTAACCAGG + Intergenic
1127947376 15:63769085-63769107 CAATCGTAACTGACTGAAGCTGG - Intronic
1128869880 15:71146601-71146623 CAATAGCAACTGGCATAAACAGG + Intronic
1129417141 15:75391290-75391312 GCTTGGCCACTGACTTAACCTGG - Intronic
1132037164 15:98494045-98494067 CAATGGCAACTGACTTAACCAGG + Intronic
1133591385 16:7247725-7247747 CAATGGAAATGTACTTAACCTGG - Intronic
1141014555 16:80436679-80436701 CAAAGGCAACTGAATTCACCAGG + Intergenic
1142560880 17:808131-808153 CGATGGGGACTGTCTTAACCAGG + Intronic
1144418913 17:15077751-15077773 AATTGGCAACTGACTTTACCAGG + Intergenic
1146376512 17:32298317-32298339 CCAAGGCTCCTGACTTAACCAGG + Intronic
1146629780 17:34461631-34461653 CAAGTGCAACTGACATAAACAGG + Intergenic
1148937854 17:51178478-51178500 CATGGGGAACTGACTAAACCAGG - Exonic
1150190603 17:63233576-63233598 CACTGGCAACTGAGGTATCCAGG - Intronic
1150683566 17:67302464-67302486 AAATAGCAACTGTCTTAGCCTGG + Intergenic
1152847068 17:82607690-82607712 CAAAGAAAACTGACTTATCCAGG + Intronic
1155762765 18:29588279-29588301 CACTGGCAACTGAGGTATCCAGG + Intergenic
1159593057 18:70355749-70355771 CAAAGGCAAGTGACAGAACCAGG - Intergenic
1165946771 19:39448105-39448127 AAATGGCAACTAACATATCCTGG - Intronic
1166587741 19:43965885-43965907 AAATTGCAAGTGACCTAACCAGG + Exonic
1166590742 19:43996174-43996196 AAATTGCAAAAGACTTAACCAGG + Exonic
1166594329 19:44031898-44031920 AAATTGCAAGTGACTTAACCAGG + Exonic
1166597841 19:44066145-44066167 AAATTGCAAGTGATTTAACCAGG + Exonic
1166602188 19:44106477-44106499 AAATTGCAAGTGATTTAACCAGG + Exonic
1166604755 19:44130931-44130953 AAATTTCAAGTGACTTAACCAGG + Exonic
1166609298 19:44175579-44175601 AAATTGCAAATGACTTAACCAGG + Exonic
925151549 2:1618705-1618727 CAGTGGGAACAGACTGAACCAGG - Intergenic
926769171 2:16352692-16352714 AAATGGCAAATGAGTTAAACTGG - Intergenic
930009610 2:46925969-46925991 TAATGGGATCAGACTTAACCTGG + Intronic
931046381 2:58358445-58358467 CAATGACAAATGACTGATCCTGG - Intergenic
931113741 2:59142111-59142133 AAATGACAACTGACTTTCCCAGG - Intergenic
931976740 2:67651692-67651714 GAATGGCAACTGCATTAAGCTGG + Intergenic
935952739 2:108345579-108345601 CACTGGCAACTGAGGTATCCAGG - Intergenic
939159843 2:138575036-138575058 TAAAGGAACCTGACTTAACCTGG + Intergenic
941773333 2:169365145-169365167 AAATTGCAACTGAATTAACCTGG - Intergenic
942240178 2:173955788-173955810 CAATTGCAACTCCCTGAACCTGG + Exonic
1171973081 20:31576792-31576814 AAATGGCAACTGACTGAAATGGG - Intronic
1173126282 20:40339081-40339103 CTTTGGAATCTGACTTAACCTGG + Intergenic
1174516504 20:51096501-51096523 CTCAGGCAAGTGACTTAACCTGG + Intergenic
1181711905 22:24696387-24696409 CCATGGTCACTGACTTAATCAGG - Intergenic
1183515063 22:38260705-38260727 CAATGGCAGCTGACATCACATGG - Intronic
1184145936 22:42610571-42610593 ACATGTCAACTGACTTAACTGGG + Intronic
952046092 3:29322583-29322605 GCATGGCAACTGACTTGATCTGG - Intronic
959299073 3:104576164-104576186 CACTGGCAACTGAGGTATCCAGG - Intergenic
959737985 3:109682971-109682993 AAATTGCATCTGACTTAAGCTGG + Intergenic
961516141 3:127438217-127438239 CAATGGCAAAGGACATAAACAGG + Intergenic
961617406 3:128193704-128193726 CAATGGCAAGTGACTTGCCTAGG + Intronic
963764458 3:149319883-149319905 TAATGGCCTCTGACTTAGCCTGG - Exonic
964423270 3:156527231-156527253 CACAGGCAAGTTACTTAACCTGG + Intronic
967359312 3:188611507-188611529 CAATTGCAACAGATTTACCCAGG + Intronic
970164880 4:13226298-13226320 CACTGGCAACTGAGGTATCCAGG + Intergenic
970467104 4:16335493-16335515 CAATGGCAACAGACTCAAGAGGG - Intergenic
970562052 4:17291946-17291968 GAATGGCAATTTACTTAAGCAGG + Intergenic
971286159 4:25291731-25291753 AAATGGCAACTGAGGTATCCAGG - Intergenic
971523534 4:27586124-27586146 CAATGGCAACCGACAGAACATGG + Intergenic
982372209 4:154646811-154646833 CACTGGCAACTGAGGTATCCAGG + Intronic
986189961 5:5487118-5487140 CCCTGACAAGTGACTTAACCTGG + Intronic
986873742 5:12081257-12081279 CAATGGCAACAGCCTTATGCAGG - Intergenic
987988685 5:25181774-25181796 CACTGGCAACTGAGGTATCCAGG - Intergenic
990015947 5:51063375-51063397 CACTGGCAACTGAGGTATCCAGG + Intergenic
996638951 5:125729918-125729940 CACTGGCAACTGAGGTATCCAGG + Intergenic
998600804 5:143582901-143582923 CAAAGGAAACTGACCTAAACTGG - Intergenic
1000927335 5:167209888-167209910 CAGTGGCCACTGAATTAACATGG + Intergenic
1001237255 5:170040739-170040761 GAATGGCACCTAACTTATCCAGG + Intronic
1008232461 6:49000098-49000120 CAGTTGCAACTGAGTTAACTTGG + Intergenic
1009611794 6:65953757-65953779 CAATCACAACTGATTTAACAAGG + Intergenic
1011793636 6:90928186-90928208 CAATCACAGCTGACTTTACCAGG - Intergenic
1012442775 6:99277128-99277150 CAATGGCAAATGGATCAACCTGG + Exonic
1014422206 6:121260438-121260460 CACTGGCAACTGAGGTATCCAGG + Intronic
1020761125 7:12269365-12269387 CAATTGCAACTGTCTAAGCCGGG + Intergenic
1021944720 7:25715463-25715485 GAAGGGCATCTGACTTAACCTGG - Intergenic
1022189127 7:27999852-27999874 CCATGGTAAATGACTTTACCAGG + Intronic
1031558118 7:123203673-123203695 CAATAGCAATTGAATAAACCTGG - Intergenic
1033868339 7:145719002-145719024 CACTGGCAACTGAGGTATCCAGG - Intergenic
1035442884 7:158918120-158918142 CATTGGGAACTGACATGACCCGG - Intronic
1038875491 8:31543869-31543891 CAATGGCAAATGGCTTGACTGGG - Intergenic
1041341128 8:56847058-56847080 CACTGGCAACTGAAGTATCCAGG + Intergenic
1044484538 8:92735767-92735789 CAATGGGAAATGACTTAAGGAGG + Intergenic
1044688764 8:94855756-94855778 AATTGGCAACTGACTTAATGTGG + Intronic
1051718035 9:20005761-20005783 CAAAGGCCAGTGATTTAACCAGG + Intergenic
1052452223 9:28646076-28646098 TAATGGCAACTGACTCAAAGTGG + Intronic
1190924287 X:54888133-54888155 CACTGGCAACTGAGGTATCCAGG + Intergenic
1191157016 X:57284694-57284716 CAATGGCAATATACTTAACATGG + Intergenic
1192985732 X:76396593-76396615 CAATGGCAATTGAAACAACCTGG - Intergenic
1194729655 X:97438894-97438916 CAAATGCAACTGAATTAAGCAGG - Intronic
1194930323 X:99880373-99880395 CACTGGCAACTGAGGTATCCAGG + Intergenic
1194975858 X:100395544-100395566 AAAAGGCAAATGACTTACCCAGG - Intronic
1195812562 X:108850999-108851021 CACTGGCAACTGAGGTATCCAGG + Intergenic
1196284612 X:113864367-113864389 CACTGGCAACTGAGGTATCCAGG - Intergenic
1197302894 X:124802648-124802670 CAATGGCAACCGAGGTATCCAGG - Intronic
1197813719 X:130475114-130475136 AAATGCCCACTGACTTCACCAGG - Intergenic
1199438954 X:147846474-147846496 CATTGCCCACTGACTTAACATGG + Intergenic
1200703397 Y:6421203-6421225 CAATGGCAGCTGAGATACCCCGG - Intergenic
1200946735 Y:8848677-8848699 CACTTGCCACTGAATTAACCTGG + Intergenic
1201030713 Y:9743504-9743526 CAATGGCAGCTGAGATACCCCGG + Intergenic