ID: 1132043966

View in Genome Browser
Species Human (GRCh38)
Location 15:98548643-98548665
Sequence AGGACGGAGGATGCCTTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132043966_1132043970 -1 Left 1132043966 15:98548643-98548665 CCAGAAAAGGCATCCTCCGTCCT No data
Right 1132043970 15:98548665-98548687 TAGATCCAGCCTGTATTTCACGG No data
1132043966_1132043973 30 Left 1132043966 15:98548643-98548665 CCAGAAAAGGCATCCTCCGTCCT No data
Right 1132043973 15:98548696-98548718 TCCTCCCCCATCCCCAAAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132043966 Original CRISPR AGGACGGAGGATGCCTTTTC TGG (reversed) Intergenic
No off target data available for this crispr