ID: 1132049705

View in Genome Browser
Species Human (GRCh38)
Location 15:98596836-98596858
Sequence CAGGACGACTGGAGGGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132049705_1132049716 28 Left 1132049705 15:98596836-98596858 CCTGCTGCCCTCCAGTCGTCCTG No data
Right 1132049716 15:98596887-98596909 AAATAACTTTTATTGTTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132049705 Original CRISPR CAGGACGACTGGAGGGCAGC AGG (reversed) Intergenic
No off target data available for this crispr