ID: 1132050212

View in Genome Browser
Species Human (GRCh38)
Location 15:98601512-98601534
Sequence GACTCTGCCTTGGTGGGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132050212_1132050219 -2 Left 1132050212 15:98601512-98601534 CCCGGCCCCACCAAGGCAGAGTC No data
Right 1132050219 15:98601533-98601555 TCTCTCTCTGTCTCCCAGGCTGG 0: 206
1: 8446
2: 113933
3: 193410
4: 193408
1132050212_1132050220 8 Left 1132050212 15:98601512-98601534 CCCGGCCCCACCAAGGCAGAGTC No data
Right 1132050220 15:98601543-98601565 TCTCCCAGGCTGGAGTGCAGTGG 0: 7132
1: 157430
2: 233611
3: 215285
4: 135185
1132050212_1132050223 19 Left 1132050212 15:98601512-98601534 CCCGGCCCCACCAAGGCAGAGTC No data
Right 1132050223 15:98601554-98601576 GGAGTGCAGTGGCACAGTCACGG 0: 241
1: 3764
2: 24613
3: 70495
4: 130175
1132050212_1132050218 -6 Left 1132050212 15:98601512-98601534 CCCGGCCCCACCAAGGCAGAGTC No data
Right 1132050218 15:98601529-98601551 AGAGTCTCTCTCTGTCTCCCAGG 0: 69
1: 2629
2: 38606
3: 140855
4: 185640

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132050212 Original CRISPR GACTCTGCCTTGGTGGGGCC GGG (reversed) Intergenic
No off target data available for this crispr