ID: 1132051497

View in Genome Browser
Species Human (GRCh38)
Location 15:98611247-98611269
Sequence CTCTTGCTGGAGCTTGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132051497_1132051502 13 Left 1132051497 15:98611247-98611269 CCAGGCACAAGCTCCAGCAAGAG No data
Right 1132051502 15:98611283-98611305 GTGGACAGACTAACTCCACTGGG No data
1132051497_1132051500 -6 Left 1132051497 15:98611247-98611269 CCAGGCACAAGCTCCAGCAAGAG No data
Right 1132051500 15:98611264-98611286 CAAGAGAGGTCTATTATGTGTGG No data
1132051497_1132051501 12 Left 1132051497 15:98611247-98611269 CCAGGCACAAGCTCCAGCAAGAG No data
Right 1132051501 15:98611282-98611304 TGTGGACAGACTAACTCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132051497 Original CRISPR CTCTTGCTGGAGCTTGTGCC TGG (reversed) Intergenic
No off target data available for this crispr