ID: 1132055674

View in Genome Browser
Species Human (GRCh38)
Location 15:98648984-98649006
Sequence CCTCAGCGCCGCCGCCGCCG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 495
Summary {0: 1, 1: 0, 2: 7, 3: 77, 4: 410}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132055674_1132055688 20 Left 1132055674 15:98648984-98649006 CCGCGGCGGCGGCGGCGCTGAGG 0: 1
1: 0
2: 7
3: 77
4: 410
Right 1132055688 15:98649027-98649049 AGCCAGGAGGAGGAGGAGGAGGG 0: 2
1: 6
2: 95
3: 699
4: 3636
1132055674_1132055687 19 Left 1132055674 15:98648984-98649006 CCGCGGCGGCGGCGGCGCTGAGG 0: 1
1: 0
2: 7
3: 77
4: 410
Right 1132055687 15:98649026-98649048 GAGCCAGGAGGAGGAGGAGGAGG 0: 2
1: 23
2: 189
3: 2038
4: 10167
1132055674_1132055683 7 Left 1132055674 15:98648984-98649006 CCGCGGCGGCGGCGGCGCTGAGG 0: 1
1: 0
2: 7
3: 77
4: 410
Right 1132055683 15:98649014-98649036 CGGCGGCGAGCGGAGCCAGGAGG 0: 1
1: 0
2: 2
3: 25
4: 223
1132055674_1132055689 21 Left 1132055674 15:98648984-98649006 CCGCGGCGGCGGCGGCGCTGAGG 0: 1
1: 0
2: 7
3: 77
4: 410
Right 1132055689 15:98649028-98649050 GCCAGGAGGAGGAGGAGGAGGGG 0: 2
1: 4
2: 102
3: 862
4: 3908
1132055674_1132055682 4 Left 1132055674 15:98648984-98649006 CCGCGGCGGCGGCGGCGCTGAGG 0: 1
1: 0
2: 7
3: 77
4: 410
Right 1132055682 15:98649011-98649033 AGGCGGCGGCGAGCGGAGCCAGG 0: 1
1: 0
2: 6
3: 46
4: 400
1132055674_1132055684 10 Left 1132055674 15:98648984-98649006 CCGCGGCGGCGGCGGCGCTGAGG 0: 1
1: 0
2: 7
3: 77
4: 410
Right 1132055684 15:98649017-98649039 CGGCGAGCGGAGCCAGGAGGAGG 0: 1
1: 1
2: 5
3: 23
4: 310
1132055674_1132055680 -10 Left 1132055674 15:98648984-98649006 CCGCGGCGGCGGCGGCGCTGAGG 0: 1
1: 0
2: 7
3: 77
4: 410
Right 1132055680 15:98648997-98649019 GGCGCTGAGGGAGGAGGCGGCGG 0: 1
1: 1
2: 27
3: 214
4: 2142
1132055674_1132055686 16 Left 1132055674 15:98648984-98649006 CCGCGGCGGCGGCGGCGCTGAGG 0: 1
1: 0
2: 7
3: 77
4: 410
Right 1132055686 15:98649023-98649045 GCGGAGCCAGGAGGAGGAGGAGG 0: 1
1: 0
2: 27
3: 324
4: 2339
1132055674_1132055685 13 Left 1132055674 15:98648984-98649006 CCGCGGCGGCGGCGGCGCTGAGG 0: 1
1: 0
2: 7
3: 77
4: 410
Right 1132055685 15:98649020-98649042 CGAGCGGAGCCAGGAGGAGGAGG 0: 1
1: 0
2: 0
3: 55
4: 531
1132055674_1132055681 -3 Left 1132055674 15:98648984-98649006 CCGCGGCGGCGGCGGCGCTGAGG 0: 1
1: 0
2: 7
3: 77
4: 410
Right 1132055681 15:98649004-98649026 AGGGAGGAGGCGGCGGCGAGCGG 0: 1
1: 4
2: 17
3: 120
4: 1053
1132055674_1132055691 22 Left 1132055674 15:98648984-98649006 CCGCGGCGGCGGCGGCGCTGAGG 0: 1
1: 0
2: 7
3: 77
4: 410
Right 1132055691 15:98649029-98649051 CCAGGAGGAGGAGGAGGAGGGGG 0: 9
1: 164
2: 3215
3: 8932
4: 17997

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132055674 Original CRISPR CCTCAGCGCCGCCGCCGCCG CGG (reversed) Exonic
900113527 1:1019555-1019577 CCTCCGCGCCGCAGCTCCCGGGG + Intergenic
900205015 1:1427937-1427959 CCGCAGCCCCGCCCCCGCCACGG + Intergenic
900269174 1:1778424-1778446 GCTCGGCGGCGCCGGCGCCGGGG - Intronic
900305287 1:2003789-2003811 CCTCCGCGGCGCCGGCGGCGTGG + Exonic
900364806 1:2306781-2306803 CCGCAGCGCCGCCGACAACGCGG + Exonic
900382495 1:2391809-2391831 CCTCCGCGGCGCCGCCTCCAGGG - Intronic
900483702 1:2911398-2911420 CAGCAGCGCCGCGGCGGCCGCGG - Intergenic
900578038 1:3393999-3394021 CCCTGGAGCCGCCGCCGCCGCGG - Intronic
901797942 1:11691498-11691520 CCTAGGCGCCGCCGCCGCGAGGG - Exonic
902400831 1:16155855-16155877 GCCCTGCGCCGCCGCGGCCGCGG + Exonic
902475758 1:16686108-16686130 CCTCGGAGCAGCAGCCGCCGCGG - Intergenic
902533414 1:17105045-17105067 CCACAGCGCGGCCCCAGCCGGGG - Exonic
903514737 1:23902841-23902863 CAGCAACGCCGGCGCCGCCGTGG - Intronic
903639402 1:24848321-24848343 CCTCCGCGCCTCCCCCGGCGGGG + Intergenic
903759097 1:25685359-25685381 CCTCAGCTCTGCTGCCACCGCGG + Intronic
903925125 1:26826605-26826627 CCGCAGCGCCCCCTCCGCCTGGG - Intergenic
904252951 1:29237747-29237769 CCGCAGCCCCGGCGCCGCCTCGG - Intronic
904620453 1:31772032-31772054 CCGCGCCGCCGCCGCCGCCACGG - Intergenic
904641988 1:31938059-31938081 CGCCGCCGCCGCCGCCGCCGAGG - Exonic
904696814 1:32335786-32335808 TCTCGGCGCCGCAGCCCCCGCGG - Intronic
904750984 1:32741571-32741593 CCTCAGTGCCGCCCCCTCCCGGG + Intergenic
904772211 1:32886634-32886656 CCCCAGCGCCCCCGCCACCCGGG - Intronic
904941015 1:34164911-34164933 GCTCAGCGTCTCGGCCGCCGCGG - Exonic
905449285 1:38046642-38046664 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
905546439 1:38804055-38804077 CCCCAGCCCGGACGCCGCCGAGG - Intergenic
906204395 1:43979335-43979357 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
906534519 1:46544177-46544199 GCCCATCGCTGCCGCCGCCGGGG - Intergenic
906627023 1:47333822-47333844 CCGCCGCGGCCCCGCCGCCGTGG - Exonic
906960920 1:50419099-50419121 CGCCGCCGCCGCCGCCGCCGGGG - Exonic
906961009 1:50419468-50419490 CCTCCTCGCCGCCGCCGCCAGGG + Exonic
908534632 1:65066694-65066716 TCTCCGGACCGCCGCCGCCGCGG + Intergenic
909075645 1:71047736-71047758 CCCTGGCGCCGCCGCGGCCGCGG - Exonic
911039819 1:93582808-93582830 CCTCAGCGCCTCCCCAGCCCTGG + Exonic
911188826 1:94927671-94927693 CCTCTGCCCCGCTGCCGCCCAGG + Intergenic
914043982 1:144076804-144076826 CTTTTGCGCCCCCGCCGCCGCGG + Intergenic
914237334 1:145823950-145823972 CGTCGCCGCCGCCGCCGCCTCGG + Exonic
914286155 1:146228794-146228816 CTCCTCCGCCGCCGCCGCCGCGG + Exonic
914815573 1:151059745-151059767 CCTCAAGGCCGCCGCCCCTGCGG + Exonic
915246348 1:154558628-154558650 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
915511207 1:156388046-156388068 CCTCAACGCCGCTGGCCCCGCGG - Intergenic
916065505 1:161132641-161132663 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
917904608 1:179576090-179576112 CTTCAGCGCCGCCCCGGCCGTGG - Intergenic
918015957 1:180632460-180632482 CCGCAGCCCCGCTGCCGCCGGGG + Intronic
920260538 1:204685270-204685292 GGGCAGCGCCGCCGCCGCCGGGG - Intronic
920541841 1:206784660-206784682 CCACACCCCCGCCGCCCCCGGGG - Intergenic
921060270 1:211579066-211579088 CCTCAGTCCAGCCGCCGCAGAGG - Intergenic
921329291 1:214019583-214019605 CCTCAGGGCAGCAGCCGTCGTGG + Intronic
921945702 1:220884599-220884621 CCGAGGCGCCGCCGCCGCCAAGG - Exonic
922502933 1:226110224-226110246 CCCCAGCCCGGCCTCCGCCGCGG - Intergenic
922602909 1:226870686-226870708 CCTCAGCGCCGCAGGCGACAGGG - Intronic
922753740 1:228082874-228082896 CCCTGTCGCCGCCGCCGCCGCGG - Intronic
923163476 1:231337777-231337799 TATCGGCGCCGCAGCCGCCGCGG + Exonic
923372615 1:233328135-233328157 CCACAGCCCCGCGCCCGCCGAGG - Exonic
924289724 1:242524715-242524737 CCCCGCCGCCGCCGCCGCCCCGG - Intergenic
924754786 1:246931492-246931514 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1064022877 10:11823626-11823648 GCCCGGCGCCGCCGCCGCAGAGG + Intronic
1064274197 10:13891771-13891793 CCCCGCCGCCGCCCCCGCCGCGG + Intronic
1064443172 10:15371242-15371264 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1064712435 10:18140768-18140790 CGCCACCGCCGCCGCCGCTGTGG - Exonic
1064981956 10:21174165-21174187 CCTCGCCGCCGCCGCCGCGCAGG + Intronic
1065069027 10:22003351-22003373 CGTTCCCGCCGCCGCCGCCGCGG - Exonic
1067236962 10:44459170-44459192 CCACAACCCCGCCGCCCCCGTGG + Intergenic
1069081098 10:64088837-64088859 GCTCACCGCCTCCGCCTCCGGGG - Intergenic
1070305028 10:75234778-75234800 CCTCAGGGCCGCCGGGGCCGCGG - Intronic
1070800837 10:79243560-79243582 CCGCGCCGCCGCCGCCGCCGGGG + Intronic
1071997519 10:91162877-91162899 CAGCGCCGCCGCCGCCGCCGCGG + Intergenic
1071997722 10:91163507-91163529 CAGCAGCGGCGCCTCCGCCGAGG + Intronic
1073812432 10:107164951-107164973 ACTCTGCGCCCCCGCGGCCGCGG + Intergenic
1073921734 10:108466637-108466659 ACTCTGCGCCCCCGCAGCCGCGG + Intergenic
1074772410 10:116742536-116742558 CCCGAGCGCCGCCGCGGACGCGG - Exonic
1074815149 10:117137194-117137216 CCTCGCAGCCTCCGCCGCCGGGG + Intronic
1075768853 10:124916958-124916980 CCTCAGTGCCCCCGCCCCCCGGG + Intergenic
1076116962 10:127907443-127907465 CCCCGGCCCCGCCGCCCCCGCGG + Intronic
1076487444 10:130833769-130833791 CCCCACCTCCCCCGCCGCCGAGG - Intergenic
1076638912 10:131901018-131901040 CGCCGCCGCCGCCGCCGCCGGGG - Exonic
1076792536 10:132784927-132784949 CCCCCGCGCCGCCGCCGCACGGG + Exonic
1077194541 11:1272562-1272584 CCTCAGCGCAGCGGCCCCCGGGG + Intergenic
1077214546 11:1389998-1390020 CGCCGCCGCCGCCGCCGCCGAGG - Intronic
1078659824 11:13277857-13277879 ACTCACCGCCGCCGCCGCCGCGG + Exonic
1079689405 11:23403534-23403556 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1082986080 11:59172361-59172383 GCGCGCCGCCGCCGCCGCCGGGG - Intronic
1083623650 11:64060936-64060958 CCCCGCCGCCGCCGCCGCCGCGG - Intronic
1083922315 11:65787507-65787529 CCGCAGCCTCGACGCCGCCGCGG - Intronic
1083970302 11:66070403-66070425 CGCCCCCGCCGCCGCCGCCGCGG + Intronic
1083970307 11:66070406-66070428 CCCCGCCGCCGCCGCCGCGGGGG + Intronic
1084546752 11:69818611-69818633 CCCCGGCGCCGCCTCCCCCGCGG + Intronic
1084892780 11:72244565-72244587 CCTCAGCCCCGCCCCCAGCGAGG + Intronic
1085052675 11:73387855-73387877 GCTCAGGGCCGCCGCGGCTGAGG - Intronic
1085295662 11:75430318-75430340 GGCCAGCGCCGCCGCCGCCCCGG + Exonic
1086887838 11:92224978-92225000 CGCCGCCGCCGCCGCCGCCGGGG - Intergenic
1087241824 11:95789538-95789560 CCCGAGAGCCGCCGCCGCCCGGG + Exonic
1089432715 11:118436697-118436719 GCTTCCCGCCGCCGCCGCCGCGG - Exonic
1089563237 11:119356481-119356503 CCGCAGCGCCCGCGCCTCCGAGG - Exonic
1090402278 11:126456557-126456579 CCTCAGAGCAGCCCCCGCCCTGG + Intronic
1091335338 11:134762206-134762228 CAGCAGCGCAGACGCCGCCGGGG + Intergenic
1093464976 12:19439851-19439873 CAGCAGCGCCGCCACCGCCTCGG - Exonic
1094025804 12:25958832-25958854 CCCCAGCGCCAACGCCGCCGCGG - Intergenic
1094564892 12:31590677-31590699 GCTCAGCGCCGCCGCAGCCCTGG + Intronic
1094652479 12:32391199-32391221 TCTCAGCGCCTCCTCCGCCTCGG - Intergenic
1096073567 12:48788936-48788958 CCCCCGCCCCGCCGCCCCCGCGG + Intronic
1096771731 12:53939655-53939677 CCCGAGCGCCGCCGCCGCCGGGG + Intronic
1096983740 12:55743399-55743421 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1097264420 12:57737514-57737536 CGCCACCGCCGCCGCCGCCGGGG - Exonic
1097989927 12:65824205-65824227 CCCGGGCGCCGCCGCCGCCGAGG + Exonic
1098255432 12:68611078-68611100 GCCCCGCGCGGCCGCCGCCGCGG - Intronic
1100315623 12:93441988-93442010 CGTCGCCGCAGCCGCCGCCGAGG + Exonic
1100444814 12:94650579-94650601 GCCCTGCGCCGCCGCCGCCGCGG + Intergenic
1101371884 12:104138027-104138049 CGCCAACGCCGCCGCGGCCGGGG - Intronic
1101466923 12:104958361-104958383 GCGCAGCCGCGCCGCCGCCGGGG + Intronic
1101592898 12:106139193-106139215 CGCCGCCGCCGCCGCCGCCGTGG - Exonic
1101605885 12:106247623-106247645 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1101781820 12:107844492-107844514 CCTCTGCGCCGTCTCTGCCGCGG + Intergenic
1102025873 12:109714153-109714175 TCTCAGCGCCGAGGCCCCCGAGG + Intergenic
1102254057 12:111406026-111406048 CCCCCGGGCCGCCGCCGCCGGGG - Exonic
1102370948 12:112382090-112382112 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1102469997 12:113154457-113154479 CCTCAGCGCCGCCTGCGTCTCGG - Exonic
1102853864 12:116277234-116277256 CCGGGCCGCCGCCGCCGCCGGGG + Exonic
1102853961 12:116277514-116277536 CCTCGGAGCCGCCGCCGCCGCGG + Intergenic
1103364018 12:120369341-120369363 TCCCGGCGCCGCCGCCTCCGCGG - Intergenic
1103563278 12:121803690-121803712 CCTCAGAGCCGCGACCGCCGCGG - Intergenic
1104049562 12:125186488-125186510 CCCCGCCGCCGCCGCCGCCGCGG - Intergenic
1104746677 12:131215196-131215218 CCTCAGCGCCCCCTCTGCAGCGG - Intergenic
1104916681 12:132269167-132269189 CCTCAGCGCTGAGGCCGCCCTGG - Intronic
1105011901 12:132761790-132761812 CCACAGCATCGCCGCCGCCCGGG + Exonic
1105492548 13:20902718-20902740 CCCCAGCGCCGCCGCCATCATGG + Exonic
1105557384 13:21459467-21459489 CCTCACCGCCTCCCCGGCCGCGG - Intergenic
1105943640 13:25171580-25171602 TGACAGCCCCGCCGCCGCCGCGG + Exonic
1106208405 13:27620500-27620522 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
1106517196 13:30465525-30465547 AGTCAGCGCGGACGCCGCCGGGG + Intronic
1107133327 13:36919686-36919708 CCCGACCGCCGCCCCCGCCGCGG + Intronic
1107133432 13:36920057-36920079 CCCCAACCCCGCCCCCGCCGTGG + Intronic
1108690019 13:52851297-52851319 TCCCGGCGCCGCCGCCGTCGTGG - Intergenic
1113789920 13:113022771-113022793 CCTCCCCTCAGCCGCCGCCGCGG - Intronic
1115664803 14:35534666-35534688 CCCCGGGGGCGCCGCCGCCGTGG + Exonic
1116003261 14:39266879-39266901 TCTCGCCGCCGCCGCCACCGCGG + Intronic
1116817862 14:49599795-49599817 CCGCGGCGCTGCCGCCGCCGCGG - Intronic
1117565564 14:56990928-56990950 CCTCAGCGCCTCCTCTGCCTGGG + Intergenic
1117803135 14:59465068-59465090 CCCCAGCGCCGCGGTCGCCACGG + Exonic
1118366674 14:65102361-65102383 CCTCCCCGCCGCCGCTGCAGTGG - Exonic
1118607700 14:67515405-67515427 CGCCGCCGCCGCCGCCGCCGGGG - Intronic
1118849479 14:69573085-69573107 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1119249037 14:73136551-73136573 CCGCCGCCCCGCTGCCGCCGCGG - Exonic
1119484916 14:74980924-74980946 CCGCGCCGCCGCCGCCACCGTGG - Intergenic
1122082153 14:99273638-99273660 CCTCAGCGCCGCCTCCCTCGGGG + Intergenic
1122221170 14:100239799-100239821 CCTCAGCGGCGGGGCCGGCGCGG + Exonic
1122444991 14:101761696-101761718 CGCCGCCGCCGCCGCCGCCGTGG + Intergenic
1122445238 14:101762456-101762478 CCTCACCGCCGCCGCCACCCAGG - Intronic
1122993283 14:105248924-105248946 CAGCAACGCCGGCGCCGCCGTGG + Exonic
1123024887 14:105419881-105419903 CGCCGCCGCCGCCGCCGCCGAGG - Exonic
1202899792 14_GL000194v1_random:28393-28415 CCACAGCGCCGGCGCAGGCGCGG - Intergenic
1125051174 15:35299488-35299510 GCTCCGCGCTGCCGCCACCGCGG - Intronic
1125200754 15:37099072-37099094 CTGCTGCGCCGCTGCCGCCGTGG - Intronic
1125508788 15:40282031-40282053 CCGCGCCGCCGCCGCCGCTGCGG - Exonic
1125522938 15:40358259-40358281 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1125626888 15:41116154-41116176 CCTCAGCGCCGCCGCCATCTTGG - Exonic
1126150939 15:45522951-45522973 CCACTGCGCCGCCTCCGCCCAGG + Intergenic
1127071259 15:55289949-55289971 CCTCGGAGGCGCGGCCGCCGGGG - Intronic
1127165773 15:56243811-56243833 TCCCGGCCCCGCCGCCGCCGCGG + Intergenic
1128119232 15:65133547-65133569 CGCCAGCGCCGCCTCCGCCGCGG + Exonic
1128171514 15:65517589-65517611 TGTCACCGGCGCCGCCGCCGAGG - Intronic
1130115303 15:81000956-81000978 GCTCGCCGCCGCCGCCGCCTCGG - Exonic
1130305355 15:82709488-82709510 CCCCAGCGCCGGCCCCGCCCCGG - Intronic
1130348015 15:83066896-83066918 TCGCGGCGCCGCCGCCGCTGGGG - Exonic
1130382127 15:83379864-83379886 CCTCATCGCTGCCGCAGACGTGG + Intergenic
1131735473 15:95326959-95326981 GCGGAGCGCCGCAGCCGCCGCGG - Intergenic
1132055674 15:98648984-98649006 CCTCAGCGCCGCCGCCGCCGCGG - Exonic
1132365126 15:101251565-101251587 GGGCAGCGCCGCCGCCGCCGCGG + Exonic
1132453628 16:10578-10600 CCTCTGCGCCTGCGCCGGCGCGG - Intergenic
1132588144 16:715116-715138 CCCCAGCGCCGGGGCCGCCTTGG - Exonic
1132641876 16:981780-981802 CGCCGCCGCCGCCGCCGCCGAGG - Intergenic
1132883170 16:2171200-2171222 CCTCAGCCCCGCCACCACCCAGG - Intronic
1133464737 16:6018967-6018989 CGCCAGCGCCGCCGCCGCCGCGG - Intergenic
1134143632 16:11742848-11742870 CGTCAGCCGCGCCGCCGCCGCGG + Exonic
1135691318 16:24539913-24539935 CCCCGCCGCCGCCGCCGCCTCGG - Intronic
1136365216 16:29806483-29806505 CGTCGCCGCCGCCGTCGCCGCGG + Intronic
1136696528 16:32085525-32085547 CCTTTCCGCCCCCGCCGCCGCGG - Intergenic
1136715504 16:32278698-32278720 CCTCAGAGCCGCGGCAGCGGTGG - Intergenic
1136797026 16:33028799-33028821 CCTTTCCGCCCCCGCCGCCGCGG - Intergenic
1136902133 16:34050967-34050989 CCTCAGAGCCGCGGCGGCTGGGG - Intergenic
1137084471 16:36102367-36102389 CCTTTTCGCCCCCGCCGCCGCGG - Intergenic
1137708015 16:50548611-50548633 CCCCGCCGCCGTCGCCGCCGCGG + Intronic
1138425961 16:56932226-56932248 CGACACCGCCGCCGCCGCCATGG + Exonic
1139448673 16:67014075-67014097 ACGCAGCGCTGCCTCCGCCGCGG + Intergenic
1139637121 16:68264524-68264546 CGGTCGCGCCGCCGCCGCCGCGG - Intronic
1140404588 16:74700414-74700436 CCTCGGCCCCGCCGCCTCCTGGG + Intronic
1142240228 16:88941504-88941526 CCCCAACGCCTCCGCCACCGGGG + Intronic
1203054550 16_KI270728v1_random:911053-911075 CCTCAGAGCCGCGGCAGCGGTGG + Intergenic
1142760884 17:2041476-2041498 CCTCAGAGCCACGGCCGCCTAGG - Exonic
1143007456 17:3846158-3846180 CCCCAGGGCCGGCCCCGCCGGGG + Exonic
1143166333 17:4899069-4899091 CCTGGGCGCCGCCGCCCCCGAGG - Exonic
1143237940 17:5419374-5419396 GCTCTTCGCCGCCGCCGCTGGGG + Exonic
1144109999 17:12021459-12021481 CCTCGGCCCCGCCGCCGCAGTGG + Intronic
1144682765 17:17206306-17206328 CCACAGCCACGCCGCCGCAGCGG + Exonic
1144879634 17:18424670-18424692 CCTCAGCCTCTCCGCCGCCTTGG - Intergenic
1145694519 17:26775727-26775749 CCTCAGTGCCGCGGCGGCGGGGG - Intergenic
1145962868 17:28897571-28897593 CCTCCGTGCCGCCGGCGCCATGG - Exonic
1146433635 17:32822582-32822604 GCTCGGCGCGGCCGCCTCCGCGG - Intronic
1146716248 17:35089202-35089224 CCCCAGAGACGCCGCCGCGGCGG - Exonic
1147210390 17:38869815-38869837 CCTCTGCGCCGCCTCCGGCTGGG + Intergenic
1147720441 17:42536470-42536492 GCGCCGCGCCGCCGCCGCCCAGG - Exonic
1147971537 17:44220985-44221007 CCTCGGCGCCGCCGCCTCCCGGG + Intronic
1148733383 17:49851251-49851273 CCGCAGCCCACCCGCCGCCGGGG - Intergenic
1149461539 17:56833694-56833716 TGCCGGCGCCGCCGCCGCCGGGG - Exonic
1150003656 17:61456649-61456671 CGTCGTCGCCGCCGCCGCCGCGG + Exonic
1150373505 17:64661883-64661905 CCCCGCCGCCCCCGCCGCCGGGG - Exonic
1152008963 17:77699067-77699089 CCTCAGCTCGGCCGCCACCCTGG + Intergenic
1152222212 17:79075065-79075087 CTTCCCGGCCGCCGCCGCCGCGG - Exonic
1152225388 17:79090392-79090414 CCTCAGCCCCGCCGGCCCCCTGG + Intronic
1152354147 17:79798467-79798489 CCCCAGCGCCGCCCCCGCCACGG - Intronic
1152714364 17:81891436-81891458 CCCCACCGCCGCGGCCGCCCTGG + Exonic
1153040816 18:812015-812037 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1153285156 18:3449999-3450021 CGTCCGCACCGCCGCCCCCGAGG + Intronic
1153997431 18:10454518-10454540 CCCCCGGGCAGCCGCCGCCGGGG - Intergenic
1154173773 18:12068425-12068447 CCGCGCCGCCGCCGCCGCCGGGG + Intergenic
1154246317 18:12702728-12702750 AGTTGGCGCCGCCGCCGCCGGGG - Exonic
1154268212 18:12897117-12897139 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1154954784 18:21242790-21242812 CCCCCTCGCCGCCTCCGCCGGGG - Intronic
1157867049 18:51196763-51196785 CACCCCCGCCGCCGCCGCCGCGG + Exonic
1157867147 18:51197084-51197106 GCCCTGCGCCGCCGCTGCCGGGG + Exonic
1158190959 18:54828425-54828447 ACCCAGCCCCGCCGCCGCGGCGG + Exonic
1160731481 19:643476-643498 TCACAGCGCTGGCGCCGCCGCGG + Exonic
1160930464 19:1567639-1567661 CCCCGCCGCCGCCGCCGCCCCGG - Exonic
1160930702 19:1568310-1568332 CCGCGCCGCCGCCGCCGCCTCGG - Intergenic
1161069387 19:2252749-2252771 CATCAGCGCCGCCTGCGCCCCGG - Exonic
1161703246 19:5805938-5805960 GCTCGCCGCCGCCGCCGCCGGGG + Intergenic
1161973332 19:7595984-7596006 CCGCAGCCCCGGCGCCGCCATGG + Exonic
1162751759 19:12833852-12833874 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1163152818 19:15425024-15425046 CCTCCGCCCCGCAGCCACCGAGG - Exonic
1163154474 19:15432492-15432514 CGCCACCGCCACCGCCGCCGCGG - Intronic
1163370122 19:16897021-16897043 CCTCAACCCCGCCCCCTCCGCGG + Intronic
1163445151 19:17341588-17341610 CCGCAGCGCCTCTGCCGCCAGGG - Exonic
1163458024 19:17420194-17420216 CCTCTGCACCCCCGCCGCGGGGG + Exonic
1163606979 19:18280983-18281005 CGCCGCCGCCGCCGCCGCCGGGG - Exonic
1163607223 19:18281886-18281908 CCCCGGCGCCGCCTCCGCCAAGG + Intergenic
1163631398 19:18419623-18419645 GCTCCACGCCGCCGCCGCCGGGG - Exonic
1163635075 19:18433843-18433865 CCTCCGGCCCGACGCCGCCGCGG - Intronic
1163668234 19:18612957-18612979 CATCAGCGCCACCGCAGCCATGG - Exonic
1163807252 19:19406450-19406472 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1165461110 19:35944931-35944953 CCTGAGCGCCGCGGGCTCCGGGG - Exonic
1165504844 19:36219270-36219292 CCTCAGCCCCACCCCCGCAGTGG + Intronic
1165803137 19:38565194-38565216 CGTCGCCCCCGCCGCCGCCGTGG - Exonic
1166361253 19:42253868-42253890 CGCCGCCGCCGCCGCCGCCGGGG + Intronic
1166361673 19:42255130-42255152 CCTCCCCGCCGCCGCCTCCCGGG + Exonic
1166723620 19:45012071-45012093 CCCCAGCCACGCCGCCGCCTTGG + Exonic
1166736946 19:45091584-45091606 TCGCAGCGCCGGCTCCGCCGAGG + Intronic
1168073073 19:53963343-53963365 CCGAGGCGCCGCCGCCCCCGCGG - Exonic
1168093760 19:54102848-54102870 CCTCGCCGCTGTCGCCGCCGCGG + Exonic
1168336497 19:55600292-55600314 CCCCCGCCTCGCCGCCGCCGAGG + Intronic
1168612832 19:57814723-57814745 CCTTAGCGCGGCCGCCGCCATGG + Exonic
1202683212 1_KI270712v1_random:29117-29139 CTTCTGCGCCCCCGCCGCCGAGG + Intergenic
926982310 2:18584898-18584920 CCTCACCGCCGCCGCTGTCCGGG - Exonic
927168588 2:20350333-20350355 CCTCTGCGGGGCCGCCGCCTCGG - Intronic
927472265 2:23385393-23385415 CCCCAGCCCCGCGGCCGCCGCGG + Exonic
927652298 2:24920051-24920073 CCTAGCAGCCGCCGCCGCCGCGG - Intergenic
927881457 2:26692709-26692731 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
929501320 2:42493736-42493758 GCTCAGCGCTGGCGCCGGCGAGG - Exonic
929966847 2:46542851-46542873 CCGGGGCGCTGCCGCCGCCGCGG - Exonic
930011420 2:46941034-46941056 CCCCGCCGCCGCCCCCGCCGCGG - Intronic
932306353 2:70706358-70706380 CCTCGCCGCCGCCCCCGCAGGGG - Exonic
932599296 2:73112873-73112895 TCTGAGCGCCGCCGCAGCTGCGG + Exonic
932621871 2:73269465-73269487 CGACGGCGCCGCCGCCGCCGCGG - Exonic
933666860 2:84971283-84971305 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
933666981 2:84971628-84971650 CCGCGGCGCCGCTGCCGCCACGG + Intronic
934248016 2:90324088-90324110 CCCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248169 2:90324632-90324654 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248184 2:90324693-90324715 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248358 2:90325306-90325328 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248369 2:90325344-90325366 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248380 2:90325382-90325404 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248396 2:90325446-90325468 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934260998 2:91477441-91477463 CTTTTGCGCCCCCGCCGCCGCGG + Intergenic
934296814 2:91749016-91749038 CACCCTCGCCGCCGCCGCCGCGG + Intergenic
934304465 2:91809922-91809944 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
934328792 2:92042828-92042850 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
935059300 2:99593816-99593838 CCCCAGCGCGTCCGCGGCCGCGG + Exonic
935112318 2:100104804-100104826 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
935196646 2:100820245-100820267 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
935592441 2:104855292-104855314 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
935592782 2:104856389-104856411 CGCCGCCGCCGCCGCCGCCGTGG - Exonic
936410681 2:112255188-112255210 GCTCTGCGCAGGCGCCGCCGTGG + Intergenic
936569406 2:113602189-113602211 TCTCTGCGCCGGCGCCGGCGCGG + Intergenic
938496935 2:131802637-131802659 CCCCAGCGCCGGCGCAGGCGCGG - Intergenic
939969667 2:148644971-148644993 CCGCCCCGCCGCCGCCGCCCGGG + Exonic
941119110 2:161507855-161507877 CCCCGCCGCCGCCGCCGCCGCGG + Intronic
942241115 2:173964682-173964704 CGCCGCCGCCGCCGCCGCCGGGG - Intronic
942453547 2:176123025-176123047 GCTCATCGCCGCCGCTGCCGGGG - Exonic
942681290 2:178480406-178480428 CTTCAGCCCCGCCGCCGGGGAGG + Intergenic
942890493 2:180981011-180981033 CCCCACCGCCGCCGCCGCCCCGG - Intronic
943571506 2:189580771-189580793 CGCCGCCGCCGCCGCCGCCGTGG + Exonic
944831219 2:203535342-203535364 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
945466017 2:210171322-210171344 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
946325304 2:218981825-218981847 CCTCATGGCCGCCTCGGCCGGGG - Exonic
947506658 2:230713050-230713072 CCGCGCAGCCGCCGCCGCCGCGG + Exonic
947538537 2:230957546-230957568 GCCCAGCACCGCCGGCGCCGCGG - Intronic
947800853 2:232927957-232927979 CTTCAGCGCCGCCTGCGCCGTGG - Intronic
947876134 2:233469433-233469455 CCGCAGCGCCCCCGCCGTCGAGG + Exonic
948467432 2:238159061-238159083 CCTGCTGGCCGCCGCCGCCGCGG + Exonic
948824653 2:240568411-240568433 GCTCCGCTCGGCCGCCGCCGGGG - Intronic
948963275 2:241356474-241356496 CCTCAGCGCCCCCCCCGCCTGGG - Intronic
949004284 2:241636818-241636840 CCCCCGCGCCCCGGCCGCCGAGG + Intronic
1168802629 20:653180-653202 CCCCATCGTCGCCGCCGCCGCGG + Exonic
1169171830 20:3471355-3471377 CACCGCCGCCGCCGCCGCCGCGG - Exonic
1171011502 20:21511858-21511880 CCTCGCCGCCACCGCCGCCGGGG + Exonic
1171977590 20:31605405-31605427 CAGCACCGCCACCGCCGCCGCGG + Exonic
1172702666 20:36862832-36862854 CCTCCGCGCAGCAGCCCCCGCGG - Exonic
1173672875 20:44810298-44810320 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1174246856 20:49188153-49188175 CCTCCTCGCCGCCACCGCCCAGG - Exonic
1174483190 20:50845389-50845411 CCTCAGCGCCTCCTCCCCCAGGG + Intronic
1175263287 20:57688082-57688104 CCTCAGCTCAGCCTCCGCCTCGG + Intronic
1175429101 20:58890246-58890268 CCCCGAGGCCGCCGCCGCCGCGG + Intronic
1175429373 20:58891237-58891259 CCCAGCCGCCGCCGCCGCCGCGG + Intronic
1176180418 20:63747136-63747158 CCTCGCCGCCTCCGCCGCCATGG + Exonic
1176548596 21:8212230-8212252 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1176550579 21:8219195-8219217 GCTCGGCGCGGCCGCCTCCGCGG - Intergenic
1176556490 21:8256438-8256460 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1176567527 21:8395265-8395287 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1176569509 21:8402236-8402258 GCTCGGCGCGGCCGCCTCCGCGG - Intergenic
1176575429 21:8439480-8439502 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1176577421 21:8446465-8446487 GCTCGGCGCGGCCGCCTCCGCGG - Intergenic
1176619167 21:9043167-9043189 CCACAGCGCCGGCGCAGTCGCGG - Intergenic
1177011053 21:15730366-15730388 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1178513837 21:33229905-33229927 GCGCCGCGCCGCCGCCGGCGCGG - Intronic
1178534966 21:33403585-33403607 AGTCTTCGCCGCCGCCGCCGCGG + Exonic
1178992246 21:37366296-37366318 CCGCAGCCCCGCCCGCGCCGGGG - Intronic
1179209428 21:39313181-39313203 CCCCAGTGTCCCCGCCGCCGGGG - Intronic
1179597725 21:42454024-42454046 CCTCATCGCCTCAGCCGCCCGGG + Intergenic
1179921700 21:44510871-44510893 CCCCGGCCCCGCCCCCGCCGAGG - Intronic
1180225773 21:46391287-46391309 CCTCAGCGCCGCCTGCTCCTGGG - Exonic
1180342441 22:11629097-11629119 CCCCACCGCCGCCGCCATCGCGG - Intergenic
1180614674 22:17119771-17119793 GCTCAACGCCGCGGCCGCAGCGG - Exonic
1180733872 22:18001415-18001437 CCACAGCGACGCCGGCGCCGAGG - Intronic
1180733873 22:18001415-18001437 CCTCGGCGCCGGCGTCGCTGTGG + Intronic
1181026853 22:20131825-20131847 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1182237005 22:28883818-28883840 CGCCTGCGCCGCCGCCCCCGCGG + Exonic
1183683769 22:39350209-39350231 CCGCCGCCGCGCCGCCGCCGGGG - Intronic
1183720329 22:39558404-39558426 CCGCAGAGCCGCAGCCGCGGAGG - Intergenic
1185055240 22:48575801-48575823 CCGCACCATCGCCGCCGCCGGGG - Intronic
1185374291 22:50474964-50474986 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1185397658 22:50600973-50600995 CCCCAGCCCCGCCGCCGGCGCGG + Intronic
1203238467 22_KI270732v1_random:30913-30935 CGCCGCCGCCGCCGCCGCCGGGG + Intergenic
1203253480 22_KI270733v1_random:128535-128557 CCGCGCCGCCGCCGACGCCGCGG + Intergenic
1203255478 22_KI270733v1_random:135538-135560 GCTCGGCGCGGCCGCCTCCGCGG - Intergenic
1203261534 22_KI270733v1_random:173613-173635 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
951217763 3:20040597-20040619 CCCCTGCGCCGCTGCCGCCGGGG + Exonic
951907896 3:27721913-27721935 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
953947773 3:47164011-47164033 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
954110109 3:48429011-48429033 CCTCCTCGCCGTCGCCGCCGGGG - Intronic
955911573 3:63863958-63863980 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
956678016 3:71753646-71753668 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
959530731 3:107431535-107431557 GGTCACCGCCGCCGCCGCCGGGG + Intergenic
961674404 3:128555844-128555866 GCCCAGCGCCGCAGCCGCTGCGG - Intergenic
962498634 3:135966499-135966521 CCTGGCCGCCGCCGCCGCGGAGG + Intronic
963133248 3:141877036-141877058 GCACTGCGCCGCCGCCGCCCGGG - Intronic
963673481 3:148280654-148280676 CCTGAGCCTCGCCCCCGCCGTGG - Intergenic
963904455 3:150762657-150762679 CGGCCCCGCCGCCGCCGCCGGGG + Exonic
966182200 3:177197562-177197584 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
967055460 3:185825495-185825517 CCTCGGCGCCGCGCCCGCCCGGG - Intergenic
967904030 3:194486585-194486607 CCGCCGCGCCGCCTCCTCCGCGG + Intronic
968161734 3:196432358-196432380 CTTCAGCGCCGAGGACGCCGCGG + Exonic
968541862 4:1172041-1172063 CCCCAGCCCGGCCGCCGCCCTGG - Exonic
968701299 4:2059400-2059422 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
968746858 4:2364886-2364908 CCTCCGCGCCGCCTCTTCCGGGG - Intronic
969113956 4:4859995-4860017 CCCCAGCGCCGCCGCGGCCACGG + Exonic
971457809 4:26860794-26860816 CTCCCGCGCCGCCGCCGCCGCGG - Intronic
972321553 4:37977360-37977382 CGCCGCCGCCGCCGCCGCCGGGG + Intronic
975870689 4:78776093-78776115 CCGTCGCGCCGCCGCCGCCCCGG - Intergenic
978072626 4:104491565-104491587 CAGCAGCGCCGCCGCCGCCGCGG - Exonic
981782817 4:148445356-148445378 CCTCTGCCCCACCCCCGCCGTGG + Intergenic
982288762 4:153759836-153759858 CTTCCGCGCCGCCGTCCCCGCGG + Exonic
982712205 4:158768942-158768964 CCGCGCCGCCGCCGCCGCCGTGG + Intergenic
982745793 4:159103340-159103362 CCGCGGCGGCGCCGGCGCCGGGG + Intergenic
982745792 4:159103340-159103362 CCCCGGCGCCGGCGCCGCCGCGG - Intergenic
982745990 4:159104017-159104039 GCCCCGCGCCGCCGCCGCCGCGG + Intergenic
984778588 4:183504909-183504931 CCCCGGCGCCGGCCCCGCCGAGG + Intergenic
984778587 4:183504909-183504931 CCTCGGCGGGGCCGGCGCCGGGG - Intergenic
986813660 5:11385161-11385183 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
988437531 5:31193807-31193829 CTCCGCCGCCGCCGCCGCCGCGG - Exonic
989637983 5:43556765-43556787 CCTCAGGCCCGCCCCCTCCGCGG + Exonic
990955144 5:61332803-61332825 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
993901219 5:93585113-93585135 CGGCGCCGCCGCCGCCGCCGCGG - Exonic
995326476 5:110894483-110894505 TCTCAGCGCCTCCTCCGCCTGGG - Intergenic
995342257 5:111073033-111073055 GCTCCGGGACGCCGCCGCCGGGG + Intronic
996308542 5:122077768-122077790 CCTCAGCGCCGCCGGGACCCGGG - Exonic
997990803 5:138543133-138543155 CCGCCGCGGAGCCGCCGCCGGGG - Exonic
997990809 5:138543147-138543169 CGTCAGAGCCGCCGCCGCCGCGG - Exonic
998435918 5:142108795-142108817 AAGCACCGCCGCCGCCGCCGAGG - Exonic
999300012 5:150485529-150485551 CCTCGGAGCCGCCGCGGGCGCGG + Intergenic
999721154 5:154400197-154400219 CCTCACCCCCGCCCCCGCCATGG - Intronic
999731717 5:154480171-154480193 CCGCAGAGCCGCCGCAGCAGCGG - Intergenic
1000220184 5:159208220-159208242 CAACCGGGCCGCCGCCGCCGCGG + Intronic
1000302949 5:159972304-159972326 CCTGAGCCCCCCGGCCGCCGCGG + Exonic
1001065072 5:168529582-168529604 CCGCGCCGCCGCCGCCGCCTCGG - Exonic
1002456015 5:179345643-179345665 TCTTCGCGCCGCCGTCGCCGCGG + Intergenic
1003551833 6:7107683-7107705 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1003604008 6:7542778-7542800 CGTCCGCGCCGCAGCCCCCGCGG + Intronic
1004441896 6:15662451-15662473 CCTCACCGCTTCCGCCCCCGCGG - Intronic
1004561868 6:16760221-16760243 CCGCAGCGCCTCCTCCGCGGCGG + Intronic
1004627975 6:17394092-17394114 CCCCAGCGCCGCCGCCCGCCCGG + Intronic
1006472662 6:34237336-34237358 CCCCTCCGCCGCCGCCGCCGCGG - Intronic
1007630308 6:43269753-43269775 CCGAGGAGCCGCCGCCGCCGGGG - Intronic
1007784302 6:44271068-44271090 CCTGAGCCCCGCCCCCGGCGCGG - Intronic
1007902048 6:45422034-45422056 CTCCCGCGCCGCCGCCTCCGCGG - Intronic
1012399998 6:98835071-98835093 CGCCCCCGCCGCCGCCGCCGTGG - Exonic
1013117468 6:107114441-107114463 GCTCCCGGCCGCCGCCGCCGCGG + Intronic
1013472310 6:110476475-110476497 CCTCGGCGCCGCCTCCCGCGTGG + Intronic
1013836548 6:114342201-114342223 CGCCCGCGCCGCCACCGCCGGGG - Exonic
1015799207 6:137044234-137044256 CCTCCGCGCGGCCGCGGCGGTGG + Intronic
1017672242 6:156778733-156778755 CGCCTCCGCCGCCGCCGCCGGGG + Exonic
1019292255 7:256515-256537 CCTCAGCGCCGCAGCCCGGGCGG + Intronic
1019421801 7:954267-954289 GTTCAGCGCCGCCACCCCCGCGG + Intronic
1019472877 7:1230425-1230447 CCGCGGCGCCGCCGCAGCCGAGG + Intergenic
1019474246 7:1236431-1236453 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1019544977 7:1569883-1569905 CCTCGGCCTCGCCGCCGCCCCGG + Exonic
1019547944 7:1587396-1587418 CCACAGCCCCTCCGCGGCCGGGG - Intergenic
1020046706 7:5046058-5046080 CCCCAGCGCCGCCGGCTCCGGGG - Exonic
1020288817 7:6706743-6706765 CCCCAGCGCCGTCGGCTCCGGGG + Exonic
1023064845 7:36367029-36367051 CCGCCGCGCCCCCGCCACCGAGG - Intronic
1023581589 7:41689999-41690021 CCTCATCGCCGGCGTCGGCGGGG - Exonic
1024043765 7:45574291-45574313 TCGCAGCGCGGTCGCCGCCGAGG + Intronic
1025069681 7:55887599-55887621 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1025306723 7:57868141-57868163 CCTCAGAGCCGCGGCGGCGGGGG + Intergenic
1025615709 7:63114426-63114448 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1026727260 7:72879554-72879576 CCCCAGCGCCGCTGGCTCCGGGG - Exonic
1026817141 7:73521930-73521952 CCCCACCGCCGCCGCCGCGATGG - Exonic
1026923782 7:74174705-74174727 CATCGGCGCCGCCGCGGCCAAGG - Intronic
1027116569 7:75486080-75486102 CCCCAGCGCCGCCGGCTCCGGGG + Exonic
1027121895 7:75527901-75527923 CCCCAGCGCCGCCGACTCCGGGG + Intergenic
1027275232 7:76549530-76549552 CCCCAGCGCCGCCGGCTCCGGGG - Intergenic
1029080717 7:97972070-97972092 CCACAGGGCCGCCGCCCCTGGGG + Intergenic
1029098420 7:98107291-98107313 CCGCAGCCCCGTCCCCGCCGCGG - Intronic
1029720941 7:102364080-102364102 CCCCAGCGCCGCCGGCTCCGGGG - Exonic
1029996754 7:105014154-105014176 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
1030138608 7:106284264-106284286 CCTCCGCGCCGGAGCCGCAGAGG + Intronic
1031051885 7:116953446-116953468 TCGCGCCGCCGCCGCCGCCGCGG - Exonic
1033300013 7:140177026-140177048 CTGAGGCGCCGCCGCCGCCGCGG - Exonic
1034147257 7:148884212-148884234 CGCCGCCGCCGCCGCCGCCGGGG + Exonic
1034469722 7:151248756-151248778 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1034589736 7:152129069-152129091 CCGCAGCTCCCCCGCCGCCAGGG - Intergenic
1034618183 7:152436281-152436303 CTTCGCCGCCGCCGCCGCCCGGG - Intergenic
1035023067 7:155809978-155810000 TCTCCGCGCCCCCGCCGCCGGGG + Intronic
1036032710 8:4991675-4991697 GCCCAGCGCCGACGCCCCCGGGG + Intronic
1036723729 8:11201069-11201091 CCGCAGCGCCGCCGCCGACGGGG - Exonic
1036801394 8:11795036-11795058 CCTCCCCCGCGCCGCCGCCGTGG + Intergenic
1038429852 8:27491318-27491340 GCCCAGCGCCGCCGCCGCAGTGG + Intronic
1041059501 8:54022275-54022297 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1041689916 8:60678763-60678785 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1042040220 8:64581387-64581409 CCCCGCCGCCGCCGCCGCCCAGG - Exonic
1044574646 8:93754849-93754871 GCTCAGCGAAGCCGCCGCAGAGG + Exonic
1045516297 8:102863628-102863650 CGCCGCCGCCGCCGCCGCCGGGG + Intronic
1047100163 8:121667533-121667555 CCCCCGCCCCGCCCCCGCCGGGG - Intergenic
1049109852 8:140635788-140635810 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1049180516 8:141219731-141219753 CTTCAGCGCCGATGCCACCGAGG - Exonic
1049585447 8:143430648-143430670 CCTCCCCGCGGCCGCCGCCTCGG + Intergenic
1049752222 8:144290732-144290754 ACCCAGCGCGGCCGCGGCCGAGG + Intronic
1049759727 8:144326561-144326583 CCGCAGGCCCGCCGCCGCCGTGG + Exonic
1049762170 8:144336602-144336624 CCTCCCCCCCCCCGCCGCCGCGG + Intergenic
1049762199 8:144336653-144336675 GCCCGGCGCCGCCGCCCCCGGGG - Intergenic
1050230922 9:3525589-3525611 CCTCGGCGGCGGCGCCGCAGCGG + Intronic
1050230921 9:3525589-3525611 CCGCTGCGGCGCCGCCGCCGAGG - Intronic
1052362212 9:27573442-27573464 CGCCTGCGCCTCCGCCGCCGCGG + Intronic
1053697501 9:40651086-40651108 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1054308790 9:63450486-63450508 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1054489418 9:65762591-65762613 CCCCCCCCCCGCCGCCGCCGCGG + Intergenic
1055091114 9:72365281-72365303 CGCCGCCGCCGCCGCCGCCGGGG - Intergenic
1055936835 9:81611801-81611823 GATGAGCGCCGCAGCCGCCGCGG - Exonic
1056992437 9:91424003-91424025 CCTCAGCTCCCCCTCCGCGGCGG + Intergenic
1057489144 9:95508367-95508389 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1057489270 9:95508871-95508893 GCGCAGAGCCGCCGCCGCCGCGG + Intronic
1057934022 9:99221804-99221826 GCTCAGCGCCGCCCACGCCCAGG + Exonic
1058546853 9:106069684-106069706 CCCCAGCACCGCCGCCACCACGG - Intergenic
1059375254 9:113876228-113876250 CCCCAGCGCCCCCGCCCCCCCGG + Intergenic
1060555279 9:124504741-124504763 CCGCGCCGCCGCCGCCGGCGAGG + Intronic
1060598446 9:124862044-124862066 CCTCATCTCCCCCGCCCCCGAGG + Intergenic
1061144057 9:128787046-128787068 CCCCAGCGCCGCCGACCCTGCGG - Intergenic
1061196658 9:129110563-129110585 AGTCCGCGCCGCCGCCGCCGCGG + Exonic
1062341417 9:136095316-136095338 CCGCCGCCCCGCCCCCGCCGCGG - Intergenic
1062346302 9:136116905-136116927 ACCTAGCGCCGCCGCCGCCGGGG - Exonic
1062490765 9:136803845-136803867 CCCCAGCCCAGCCGCCTCCGTGG - Intronic
1202779846 9_KI270717v1_random:24374-24396 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1203469880 Un_GL000220v1:111682-111704 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1203471874 Un_GL000220v1:118673-118695 GCTCGGCGCGGCCGCCTCCGCGG - Intergenic
1203477701 Un_GL000220v1:155654-155676 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1185457757 X:319237-319259 CGCCGCCGCCGCCGCCGCCGAGG - Intergenic
1185460973 X:332686-332708 CCGCAGCGCCGCCGTCCACGAGG + Intergenic
1187535917 X:20141693-20141715 CCTCGGAGCAGCAGCCGCCGCGG - Exonic
1187900943 X:24025861-24025883 CCCCCGCGGCGCCGCCGTCGGGG + Intronic
1189391575 X:40581039-40581061 CCGCAGTGCTGCGGCCGCCGCGG + Exonic
1190298753 X:49043603-49043625 CCTAAGCGACGCCTCCGACGCGG + Intergenic
1192925002 X:75747086-75747108 CGCCACCGCCGCCGCCGCCGCGG + Intergenic
1194977593 X:100409720-100409742 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1195668351 X:107449926-107449948 CCTCAGCGGCGCGGCAGCGGCGG - Intergenic
1197448502 X:126581179-126581201 GCTCAGCGCACCCGCCTCCGCGG + Intergenic
1198451027 X:136767314-136767336 CCTGAGCGCGGCCGCCACCAGGG + Intronic
1199793785 X:151177265-151177287 CCTCAGCGCGGCCGCCCTTGCGG - Intronic
1201077154 Y:10196806-10196828 CCCCATCGCCGCCGCCGTCACGG - Intergenic