ID: 1132055795

View in Genome Browser
Species Human (GRCh38)
Location 15:98649415-98649437
Sequence TACTCCGAAGGCGGCGCCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 36}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132055795_1132055803 8 Left 1132055795 15:98649415-98649437 CCGGCGGCGCCGCCTTCGGAGTA 0: 1
1: 0
2: 0
3: 1
4: 36
Right 1132055803 15:98649446-98649468 TTCGCCCTTGTTTTTGGAGGGGG 0: 1
1: 0
2: 0
3: 9
4: 175
1132055795_1132055802 7 Left 1132055795 15:98649415-98649437 CCGGCGGCGCCGCCTTCGGAGTA 0: 1
1: 0
2: 0
3: 1
4: 36
Right 1132055802 15:98649445-98649467 CTTCGCCCTTGTTTTTGGAGGGG 0: 1
1: 0
2: 0
3: 8
4: 114
1132055795_1132055799 5 Left 1132055795 15:98649415-98649437 CCGGCGGCGCCGCCTTCGGAGTA 0: 1
1: 0
2: 0
3: 1
4: 36
Right 1132055799 15:98649443-98649465 TCCTTCGCCCTTGTTTTTGGAGG 0: 1
1: 0
2: 1
3: 14
4: 181
1132055795_1132055801 6 Left 1132055795 15:98649415-98649437 CCGGCGGCGCCGCCTTCGGAGTA 0: 1
1: 0
2: 0
3: 1
4: 36
Right 1132055801 15:98649444-98649466 CCTTCGCCCTTGTTTTTGGAGGG 0: 1
1: 0
2: 0
3: 8
4: 115
1132055795_1132055798 2 Left 1132055795 15:98649415-98649437 CCGGCGGCGCCGCCTTCGGAGTA 0: 1
1: 0
2: 0
3: 1
4: 36
Right 1132055798 15:98649440-98649462 GTTTCCTTCGCCCTTGTTTTTGG 0: 1
1: 0
2: 1
3: 14
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132055795 Original CRISPR TACTCCGAAGGCGGCGCCGC CGG (reversed) Exonic
901685653 1:10942052-10942074 TTCTCCGAAGGCTGAGCCTCAGG + Intergenic
904054330 1:27660097-27660119 TACTCCGACGGCTGCGGCGGTGG + Intergenic
917920060 1:179743595-179743617 TACGCTGAAGGCGGCGCGGTGGG - Intronic
919049803 1:192499339-192499361 CGCTCCGAATGCGGGGCCGCGGG + Intergenic
921909166 1:220528601-220528623 TACCCCGGCGGCGCCGCCGCGGG + Exonic
922250739 1:223846361-223846383 TCCTCCGGCGGCCGCGCCGCTGG + Intergenic
1076566577 10:131403361-131403383 CACTCCGAAGGGGGCGCGGACGG - Intergenic
1076674680 10:132141841-132141863 TCCTCCGATGGCGGGGCCCCGGG - Intronic
1076890702 10:133281832-133281854 CACCCCGGAGCCGGCGCCGCAGG + Intronic
1077008663 11:370444-370466 TTCACCGAAGGCGCCCCCGCCGG - Intronic
1084275635 11:68049749-68049771 TCCTCCGCAGGCGGCGGCGGTGG - Exonic
1086341783 11:85854963-85854985 TGCTACCAAGGCGGCGGCGCGGG + Intergenic
1091402092 12:187427-187449 AACTCTGAAGGCGGCGCGTCTGG + Intergenic
1129743197 15:78000213-78000235 CACTCAGAAGGAGGCGCTGCAGG + Intronic
1132055795 15:98649415-98649437 TACTCCGAAGGCGGCGCCGCCGG - Exonic
1132847970 16:2009413-2009435 CTCTCGGAAGCCGGCGCCGCCGG + Intronic
1152716307 17:81902380-81902402 TACTCGGTGGGCCGCGCCGCGGG + Exonic
1165080174 19:33302316-33302338 AAAGCCGAAGGCGGCGCTGCTGG + Exonic
1166984149 19:46649583-46649605 TCCTGCGCAGGCGCCGCCGCCGG - Exonic
927519571 2:23690669-23690691 GAGTCCGGAGGCGGCCCCGCAGG - Intronic
931708846 2:64970011-64970033 AGCTCCTAAGGCGGCGCCTCTGG - Intergenic
937020405 2:118645824-118645846 TACTCAGAAGGCGGGGCAGGAGG - Intergenic
944098750 2:195998462-195998484 TACTCAGAAGGCTGAGCAGCAGG + Intronic
946404277 2:219484256-219484278 GGCTCTGAAGGCGGCGCGGCAGG - Exonic
1172482138 20:35277526-35277548 GACTGCGAAGGCGGCCCTGCCGG + Intergenic
1176156015 20:63621086-63621108 TACTCGGAAGGCGGGGCTGGAGG + Intronic
1181965919 22:26656789-26656811 TACTCCGAAGGCTGAGGCGGGGG + Intergenic
1184698035 22:46150593-46150615 AACGCCGAAGGAGGCGGCGCCGG - Intronic
953910169 3:46888844-46888866 TGCCCCGAAGGCGGCCACGCTGG + Intronic
982288788 4:153759921-153759943 TCCGCAGAAGGAGGCGCCGCGGG + Exonic
990955103 5:61332654-61332676 AACACCGGCGGCGGCGCCGCGGG + Exonic
995462575 5:112419325-112419347 TCCTCCGAAGGCGGGGGCGCGGG + Intergenic
1032947465 7:136869931-136869953 TGCTCCGAAAGCGGAGCCGGGGG - Intronic
1037262776 8:17027108-17027130 TACGCTGAAGGTGGCGTCGCGGG + Intergenic
1038728878 8:30108872-30108894 TACTCAGAAGGCTGAGCGGCAGG - Intronic
1057546315 9:96022049-96022071 GCCTCCGAAGCCGGCGCCCCCGG + Intergenic
1187900945 X:24025863-24025885 AGCCCCGACGGCGGCGCCGCGGG - Intronic
1200093833 X:153648100-153648122 CCCTCCGCAGGCGGCGCAGCAGG - Exonic