ID: 1132057057

View in Genome Browser
Species Human (GRCh38)
Location 15:98660315-98660337
Sequence GCAGAATCAAGGCCAGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 363}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132057057_1132057059 12 Left 1132057057 15:98660315-98660337 CCTCTCTCTGGCCTTGATTCTGC 0: 1
1: 0
2: 3
3: 33
4: 363
Right 1132057059 15:98660350-98660372 TGCACTGACTTGAGCTCCTGTGG 0: 1
1: 0
2: 0
3: 9
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132057057 Original CRISPR GCAGAATCAAGGCCAGAGAG AGG (reversed) Intronic
900931355 1:5739850-5739872 ACAGAAGCCAGGCCTGAGAGTGG + Intergenic
902658999 1:17888265-17888287 GTAGAACCAAGATCAGAGAGCGG - Intergenic
903030928 1:20463850-20463872 ACAGAAACTAGGACAGAGAGAGG + Intergenic
903334523 1:22616098-22616120 GGAAACTGAAGGCCAGAGAGAGG + Intergenic
903947501 1:26972829-26972851 GCAGAATCTGGGAAAGAGAGGGG + Intergenic
904321814 1:29702606-29702628 GGAGAGTCAGGGACAGAGAGAGG - Intergenic
904421830 1:30399040-30399062 GGAGAGTCAAGGAAAGAGAGAGG + Intergenic
904785710 1:32981166-32981188 AGAAAATTAAGGCCAGAGAGGGG + Intergenic
905612046 1:39361701-39361723 GCAGAATAAAGGGAAGAGAAGGG + Intronic
906159015 1:43633854-43633876 GTAGAATCTAGGCCAGGGTGTGG + Intergenic
906307439 1:44728664-44728686 GCAGAGTGAAGGACAGACAGAGG - Intergenic
906474175 1:46156746-46156768 GCAGTACCAGGGCCAGAGTGTGG - Intronic
906523176 1:46479121-46479143 GCAGCATCACGGCCAGAGGAAGG - Intergenic
907020617 1:51063432-51063454 GCAGACTCAAGGTCAGTCAGAGG + Intergenic
907064885 1:51471050-51471072 GCAGGATCAAAGCCAGATATTGG - Intronic
911637326 1:100249616-100249638 GCAAAATAAAGGGCAGAGAACGG - Intronic
912651954 1:111448242-111448264 GCAGAATGAAGACAAGAAAGCGG + Intronic
913144915 1:115978953-115978975 ACAGCAACAAGGCCAGAGAGAGG + Intronic
913452004 1:118998866-118998888 GCAGATTGAAGGCCAGGTAGGGG + Intergenic
915559612 1:156678942-156678964 GTAGAATAGAGGCCAGGGAGGGG + Intergenic
917922299 1:179760593-179760615 GAAGCATCAAGTCCAGAGACAGG + Intronic
917941017 1:179921636-179921658 TCAGAATCCAGGCCAGAAAGAGG - Intronic
918588857 1:186219117-186219139 GCAGAGTCAAGGCCAGTGGGTGG - Intergenic
919568823 1:199221231-199221253 GCAGAAGCAATGCCAGAAAATGG - Intergenic
919901452 1:202046857-202046879 GCAGAACAAAGTCCAGAGAGAGG - Intergenic
921398574 1:214694728-214694750 GGAGAAACAGGGCCAGAGAGGGG + Intergenic
924261352 1:242234754-242234776 GCAGAATCAGGGACTGAGAAAGG - Intronic
1063187023 10:3660754-3660776 GCAGAATCAAGGACACAGCCAGG + Intergenic
1064390972 10:14941921-14941943 GCAGAATCAGGGCAAGAAATAGG - Intronic
1064401336 10:15023930-15023952 GCAGAATCAGGGCAAGAAATAGG - Intergenic
1066991136 10:42515102-42515124 GCAGGAGCAAGGGCAAAGAGAGG - Intergenic
1069336781 10:67360705-67360727 GCAGGAGCAAGAGCAGAGAGGGG + Intronic
1069877178 10:71570278-71570300 TCAGAAGAAAGGCCACAGAGGGG - Intronic
1069961371 10:72081167-72081189 GAAGAAACAGGGCCAGAGAAAGG - Intronic
1070925853 10:80221039-80221061 GAAAAATGAAGGCTAGAGAGTGG - Intergenic
1071524865 10:86352741-86352763 GCAAAACCAAGGCCAGACTGGGG - Intronic
1071841330 10:89474936-89474958 GCAGCTTAAAGGCCAGGGAGAGG - Intronic
1072859802 10:98991479-98991501 GGAGAAGAAAGGTCAGAGAGTGG + Intronic
1073420558 10:103420722-103420744 CCAGAAACAAGCCCAGTGAGGGG + Intronic
1074158900 10:110821240-110821262 GCAGAATGGAGGTCAGAGGGTGG - Intronic
1076012163 10:126998142-126998164 TCACAAACAAGGCCAGAGAAGGG - Exonic
1076206675 10:128609712-128609734 GCAGAAACAGGGCCAGCAAGTGG - Intergenic
1076288206 10:129322131-129322153 GCATAATCAAGCACAGAGATTGG + Intergenic
1076352338 10:129825869-129825891 GCAGAGTCCAGGCCGGGGAGGGG + Intergenic
1076388740 10:130079759-130079781 CCAGCACCAAGGCCAGAGAGTGG - Intergenic
1076834963 10:133016402-133016424 GCAGGGTCCAGGCCAGGGAGCGG + Intergenic
1077667260 11:4123928-4123950 GAAGAATCAAGGCTAGAAATGGG + Intronic
1077825140 11:5799789-5799811 GAAAAATCAAGGACAGAGATGGG - Intronic
1079012614 11:16841736-16841758 GCAGAATGCAGGTCAGAGGGAGG + Intronic
1079245603 11:18750081-18750103 GGAGAAACAGGCCCAGAGAGCGG + Intronic
1079509945 11:21199088-21199110 GCAAACTCAAGGGCAGAGAGAGG + Intronic
1079636857 11:22753276-22753298 GAAGAAACAAGGCCAGACTGTGG - Intronic
1080133728 11:28828022-28828044 GCAGAATAAAGGCAAAAGATTGG - Intergenic
1081660085 11:44882739-44882761 TGGGACTCAAGGCCAGAGAGTGG + Intronic
1084426369 11:69086580-69086602 CCAGAATCAGGGCCAGAAACAGG - Exonic
1084531551 11:69730702-69730724 GCAGGAGCCAGGACAGAGAGGGG + Intergenic
1084781389 11:71411943-71411965 GCAGAAGCAATGACACAGAGGGG - Intergenic
1085026210 11:73238065-73238087 GCAGACTCAAGGCCAGAGATGGG + Intergenic
1086899126 11:92346443-92346465 TCAGAGTCAATGCCACAGAGAGG - Intergenic
1088358284 11:108965946-108965968 GTAGAATCAAAGCCAGACATGGG - Intergenic
1089322225 11:117634147-117634169 GGAGCATCAAGGACAGGGAGAGG + Intronic
1089403786 11:118180918-118180940 GCAGAGCCAAGGCAAGAGAGGGG + Intergenic
1090245593 11:125213928-125213950 GCAGAAGGAGGGCCAGGGAGGGG + Intronic
1090508899 11:127350354-127350376 GGAGAAGCAAGGGAAGAGAGTGG + Intergenic
1090555147 11:127866611-127866633 GTAGAACTAAGGCCAGAGATGGG + Intergenic
1090972818 11:131657383-131657405 GAAGAATAAAGGGCAGAGGGTGG + Intronic
1090981437 11:131725950-131725972 GCAGAATCATCCCCAGAGACTGG - Intronic
1091148628 11:133304466-133304488 GCAAAAGCAATGCCAGAGAAAGG + Intronic
1092074009 12:5657824-5657846 GCATGTTCAAGGGCAGAGAGGGG + Intronic
1092253131 12:6912543-6912565 GCAGAAGCAGGACCAGAGCGGGG + Intronic
1093917998 12:24827499-24827521 CCACAATCAAGGCCAGGGTGCGG + Intronic
1096514928 12:52150486-52150508 GCAGAATCAAGGCTAGACGGGGG - Intergenic
1096623597 12:52879599-52879621 GCAGTCTCCAGGACAGAGAGTGG + Intergenic
1096985847 12:55756742-55756764 GCAGAATCAAAGCATGACAGAGG - Exonic
1099137578 12:78927238-78927260 CCAGCATCAAGGACAGAGATGGG - Intronic
1100601779 12:96117806-96117828 GCAGAACCAAGTCCAGTGATGGG + Intergenic
1101700267 12:107167371-107167393 GCAGAAACAAAGGCACAGAGTGG + Intergenic
1102424962 12:112836789-112836811 GCAGAAACAAGGGCACTGAGTGG - Intronic
1102525187 12:113507556-113507578 CCAGGTTCAAGGCCAGAGAAAGG + Intergenic
1102540644 12:113616749-113616771 ACAGAATGAAGGCCGGCGAGGGG - Intergenic
1103891087 12:124239621-124239643 GCAGAGGCCAGGACAGAGAGTGG - Intronic
1104375994 12:128266359-128266381 GCAGGAGCAAGTCTAGAGAGGGG + Intergenic
1105623886 13:22094442-22094464 CCAGGATCCAGGCCAGACAGTGG + Intergenic
1106564634 13:30873683-30873705 GCAGCATCAAGCCCAGAGGAAGG + Intergenic
1107441158 13:40428575-40428597 GCAGTATCCAGGGCAGAGAGGGG - Intergenic
1110347761 13:74468003-74468025 GCAGAATCTAGGATAGAAAGAGG - Intergenic
1113692883 13:112324181-112324203 GCAGCAGCAGGGCCAGAGACAGG + Intergenic
1113770372 13:112904357-112904379 GCAGGAACAAAGCCAGAGCGTGG - Intronic
1114160909 14:20165792-20165814 GCAGAATCAGGGCTTGAGAAGGG - Intergenic
1114482432 14:23044120-23044142 GGAGAATGAAGACAAGAGAGAGG + Exonic
1115142304 14:30186216-30186238 TGAGAATCAAGGAAAGAGAGGGG + Intronic
1116057708 14:39884629-39884651 GAAGAGAAAAGGCCAGAGAGAGG + Intergenic
1117309445 14:54507221-54507243 GAAGAATCAAGAGAAGAGAGAGG + Intergenic
1118764359 14:68899993-68900015 GCAGAAGGAAGGCCAGAGGAGGG + Intronic
1118785056 14:69038749-69038771 GCAGATCCAAGACCAGATAGTGG - Intergenic
1119915475 14:78397414-78397436 GCAGAATGGAGGACACAGAGGGG - Intronic
1119987883 14:79160310-79160332 GGAGAATCCAGGTCAGAGAAAGG - Intronic
1120151985 14:81046478-81046500 CCAAAATTAAGCCCAGAGAGGGG + Intronic
1120674266 14:87402464-87402486 GCAGAATCCTGACCAAAGAGAGG + Intergenic
1120724780 14:87925871-87925893 CCAGATTCCAGGGCAGAGAGGGG + Intronic
1121282652 14:92710426-92710448 GCAGAGCTAAGGCCACAGAGAGG + Intronic
1121576261 14:94990556-94990578 GGAGAATCAAGACCACAGGGAGG + Intergenic
1121645540 14:95515483-95515505 GCAGAAACAGGCCCAGAGAGGGG - Intergenic
1122494517 14:102143105-102143127 AGCGAACCAAGGCCAGAGAGGGG + Intronic
1124881405 15:33646076-33646098 GGAGAATAAATGCCAGAGGGGGG - Intronic
1126056702 15:44736531-44736553 GAAGCAGCAAGGCCAGAGTGAGG - Exonic
1126156789 15:45573489-45573511 GGAGAATCAAAGGGAGAGAGAGG + Intergenic
1127733906 15:61824228-61824250 GTCGAAACAAGGCAAGAGAGGGG - Intergenic
1128778629 15:70342956-70342978 GCAGCCTCAGGGCCTGAGAGGGG + Intergenic
1129078422 15:73018127-73018149 TCTGAATTAAGGCCATAGAGAGG - Intergenic
1129152152 15:73696033-73696055 GCAGAAGCAGGGCCACAGGGAGG - Intronic
1129771322 15:78205088-78205110 GCAGCATCGAGACCACAGAGAGG - Intronic
1129779393 15:78260192-78260214 GTAGAGGCAAGCCCAGAGAGAGG - Intergenic
1131171240 15:90179720-90179742 GCAGAAGCAAGGAAAGACAGGGG + Intronic
1131714282 15:95091481-95091503 GCAGAAGGAAGGCAAGAGGGAGG - Intergenic
1132057057 15:98660315-98660337 GCAGAATCAAGGCCAGAGAGAGG - Intronic
1132954901 16:2586438-2586460 TGGGAATCAGGGCCAGAGAGGGG - Intronic
1133314364 16:4873242-4873264 GTAGAACCAAGGCTAGAGGGGGG - Intronic
1133616607 16:7482872-7482894 GCAGAAGCAAAGACTGAGAGGGG + Intronic
1133886873 16:9837907-9837929 GCAAAATCAAATCCAGAGAGTGG + Intronic
1133937314 16:10279800-10279822 CAAGAAGCCAGGCCAGAGAGAGG - Intergenic
1134799251 16:17069474-17069496 ACAGAATCTATCCCAGAGAGAGG - Intergenic
1135476115 16:22776972-22776994 CCAGAATAAAGGCAACAGAGAGG + Intergenic
1135678500 16:24437458-24437480 GCAGAATCTTGGGAAGAGAGAGG + Intergenic
1136054193 16:27675841-27675863 GCAGAAGCCAGGACAGAGAGGGG - Intronic
1137546029 16:49404251-49404273 GGAGAAGCAAGCCCAGAGACAGG + Intergenic
1137846980 16:51699546-51699568 ACAGAATCCAGGTGAGAGAGGGG - Intergenic
1138205523 16:55121661-55121683 CCAGAACTAAGGCCAGGGAGGGG + Intergenic
1141169250 16:81680782-81680804 GAAGCCTCCAGGCCAGAGAGTGG + Intronic
1141224794 16:82104795-82104817 GCAGAGTCCTAGCCAGAGAGAGG - Intergenic
1142471319 17:164787-164809 ACAGAAGCATGGACAGAGAGGGG + Intronic
1143105381 17:4527472-4527494 GCAGAATAAAGTCCCGATAGGGG + Intronic
1143845785 17:9771867-9771889 GCAGAAGGAAGCGCAGAGAGTGG - Intronic
1144052617 17:11509947-11509969 GCAGACTCAAGGTCTGAGATGGG + Intronic
1145258839 17:21342844-21342866 GGGAAACCAAGGCCAGAGAGAGG + Intergenic
1145317785 17:21745160-21745182 GGGAAACCAAGGCCAGAGAGAGG - Intergenic
1145679635 17:26572342-26572364 TTAGAATGAAGGCCACAGAGTGG - Intergenic
1145974247 17:28975227-28975249 GCAGAGTCTGGGCCAGGGAGAGG - Intronic
1146143636 17:30390429-30390451 AGAAAATCAAGGCCTGAGAGAGG + Intronic
1147303690 17:39549097-39549119 TCAGAATCCAGGCAAGAGTGGGG - Intronic
1147685910 17:42286860-42286882 GAAAAACAAAGGCCAGAGAGGGG - Intergenic
1147743229 17:42680356-42680378 GCAGAGTCAGGGCCAGCAAGAGG + Exonic
1148347103 17:46910652-46910674 GAACAATCAAGGCAAGGGAGTGG + Intergenic
1150335355 17:64326674-64326696 GCAGAACCAAAGCCACAGACAGG + Intronic
1150993966 17:70294754-70294776 GGACAATGAAGGCCAGAGATAGG + Intergenic
1153134103 18:1893916-1893938 GCTGATGCAAGGACAGAGAGTGG - Intergenic
1154213149 18:12396923-12396945 ACAGAAGCAAGGGCCGAGAGGGG + Intergenic
1156272325 18:35547209-35547231 GCAGAATACAGGGCAGAGACAGG + Intergenic
1156452555 18:37274915-37274937 CCAGAAGCAGGGCCAGGGAGGGG + Intronic
1157322095 18:46642454-46642476 GCAAAAGCAAGGCCAGTGATGGG - Intronic
1157516608 18:48315862-48315884 GTATAATCAAGGCCATGGAGAGG + Intronic
1157850094 18:51040617-51040639 GCTGAATACTGGCCAGAGAGAGG - Intronic
1157934609 18:51859173-51859195 GCAGAATCAAGTGTAGTGAGAGG - Intergenic
1159944800 18:74436478-74436500 GCATGTTTAAGGCCAGAGAGTGG + Exonic
1160124262 18:76155854-76155876 ACAGCAGCAAGCCCAGAGAGAGG - Intergenic
1160864954 19:1252385-1252407 AGAGAACAAAGGCCAGAGAGAGG - Intronic
1162385190 19:10356783-10356805 GCAGAGTCAAGTCCCCAGAGTGG + Intronic
1162552607 19:11365911-11365933 GAAGAAACAAGGGCACAGAGAGG - Intergenic
1163111738 19:15165509-15165531 TGAGAATCTAGGACAGAGAGTGG + Exonic
1163113937 19:15178177-15178199 GAAGAGTCAAGGGGAGAGAGGGG + Intronic
1163321217 19:16576150-16576172 ACAGAATCCAGGCCAGCCAGTGG - Exonic
1164526709 19:29018336-29018358 GCACAATCAAGGGCAGAGAGGGG + Intergenic
1165793806 19:38507210-38507232 GCAGAGGCGGGGCCAGAGAGTGG + Intronic
1165905786 19:39193892-39193914 TCAGAATCCAGGGCAGGGAGTGG - Intergenic
1166687207 19:44802516-44802538 GAGGAATGAAGGACAGAGAGAGG - Intergenic
1166794216 19:45416680-45416702 GGAAACTGAAGGCCAGAGAGAGG + Intronic
1167686584 19:50960311-50960333 GCAGAAACAGGGACAGAGACAGG - Intronic
1168580253 19:57549594-57549616 CCAGAGTCATTGCCAGAGAGAGG + Intronic
925316983 2:2934069-2934091 GCAGAATCCAGGCCAAAAGGAGG - Intergenic
926314319 2:11698073-11698095 GCAGGATCAGGACCTGAGAGAGG - Intronic
926607960 2:14916233-14916255 GGGGAACCAAGGTCAGAGAGAGG - Intergenic
927254479 2:21028230-21028252 TCAGAAGCAAGGGCAGACAGTGG + Intronic
928132126 2:28660177-28660199 GCAGAGGCAAGGCCTAAGAGAGG + Intergenic
928157621 2:28891148-28891170 GGAGAAACAAAGCCAGAGAAGGG + Intergenic
928945087 2:36764984-36765006 GCAGAGTTAAGGCCAGAGCTGGG + Intronic
930829961 2:55732583-55732605 TCAAAATCAAGGGCAGAGAGAGG - Intergenic
932108459 2:68971083-68971105 GGGAAATCAAGACCAGAGAGGGG + Intergenic
932498589 2:72160231-72160253 GCAGCAGCGAGGCCAGAGTGAGG - Intergenic
933342221 2:81038149-81038171 GGAAAATCAAGGTCAGAGAAAGG + Intergenic
934323446 2:91985975-91985997 GCAGAGTCAAGGCCAGAACAAGG - Intergenic
936142102 2:109949181-109949203 GCAGAAGCAAGGCCAAAGCTGGG - Intergenic
936178792 2:110247141-110247163 GCAGAAGCAAGGCCAAAGCTGGG - Intergenic
936202586 2:110422292-110422314 GCAGAAGCAAGGCCAAAGCTGGG + Intronic
936393219 2:112095264-112095286 CCAGAGTCAAGGAGAGAGAGGGG - Intronic
936500478 2:113062399-113062421 GCAGAAGCAGGGGCAGAGGGAGG - Intronic
937153435 2:119701571-119701593 GCAGTGACAAGGCCACAGAGGGG + Intergenic
938699357 2:133862479-133862501 GCACACTCATGCCCAGAGAGAGG - Intergenic
941758521 2:169214838-169214860 GCCTAGTCAAGGCCAGAGAGAGG + Intronic
942173664 2:173310643-173310665 GTGTAATCAAGGCCAGGGAGAGG + Intergenic
942996467 2:182266905-182266927 TCAGAAACAAGTCCAGAGATGGG - Intronic
943188697 2:184648041-184648063 GCAGAACAAAGGCCAGATGGGGG + Intronic
944404728 2:199370696-199370718 GCAGGAGCAAGGACAAAGAGAGG - Intronic
945020195 2:205563247-205563269 GAACAATCAAGGCAAGGGAGAGG + Intronic
945043677 2:205763696-205763718 GCAGAGTGACAGCCAGAGAGAGG + Exonic
945344038 2:208691705-208691727 GCAGAAGCGAGGTCAGAGATCGG - Intronic
945550251 2:211212484-211212506 GAAGAATCAATGCCAGAAGGTGG - Intergenic
945684095 2:212948415-212948437 GCAGAAACAAGGTCTGAAAGTGG + Intergenic
947058988 2:226140585-226140607 GAAGAAGCAAGTACAGAGAGTGG + Intergenic
947100538 2:226616546-226616568 GGAGAGTCAAGGCATGAGAGGGG - Intergenic
947882804 2:233534417-233534439 AGAGACTCAAGGCCAGACAGAGG - Intronic
1170011152 20:11725443-11725465 GCAGAGTAGAGGCCAGAGATTGG - Intergenic
1170285598 20:14704857-14704879 GCAAAATCAAGGCCTGGCAGGGG + Intronic
1171213032 20:23331555-23331577 GTAGAAGCAGAGCCAGAGAGAGG + Intergenic
1171304290 20:24091974-24091996 GGAGAATAAACCCCAGAGAGGGG + Intergenic
1171959769 20:31485411-31485433 GCAGAAACAAGCCTAGAGAGGGG + Intergenic
1172192574 20:33070844-33070866 GCAGATTCAGGGCCAGAGCCTGG - Intronic
1172782906 20:37447752-37447774 GTAGAATCAAGGAAAGAAAGGGG - Intergenic
1173283073 20:41646475-41646497 GCAGACTCAAGAGCAGAGACTGG - Intergenic
1173867148 20:46319648-46319670 GAAGAAACAGGCCCAGAGAGCGG - Intergenic
1173916220 20:46710190-46710212 GCAGAATCACGTCCAGAGGAGGG - Intronic
1174110579 20:48195247-48195269 GCAGAGTCAAGGCTATAAAGAGG + Intergenic
1174712266 20:52719503-52719525 ATAGAATTGAGGCCAGAGAGAGG - Intergenic
1175172749 20:57091729-57091751 GCAGACACAAGCCCCGAGAGGGG + Intergenic
1175174237 20:57101036-57101058 GAAGAATCAGGGCCAGCGTGGGG + Intergenic
1175201878 20:57283659-57283681 GCAGAATCCAGGATATAGAGGGG + Intergenic
1179903242 21:44405941-44405963 ACAGGATGAAGTCCAGAGAGAGG - Exonic
1180064851 21:45407042-45407064 GCGGAAGCAGGCCCAGAGAGGGG + Intronic
1181363568 22:22357182-22357204 TCAGGATCAAGCCCAGAGCGGGG - Intergenic
1181366384 22:22380263-22380285 TCAGGATCAAGCCCAGAGCGGGG - Intergenic
1182729107 22:32473481-32473503 GCAGAATCAAGGGCAGGATGTGG + Intergenic
1182778622 22:32849849-32849871 GAAGATTAAAGCCCAGAGAGGGG - Intronic
1184420841 22:44382014-44382036 GCAGAGACAAAGCCCGAGAGGGG + Intergenic
1184521847 22:44999318-44999340 GCAGAACGCAAGCCAGAGAGAGG + Intronic
1184958995 22:47915167-47915189 TCAGAGTCAAGGCCAGGGTGAGG + Intergenic
1185131704 22:49043167-49043189 GCGGAATGATGTCCAGAGAGGGG + Intergenic
1185219606 22:49622777-49622799 GCAGAATCCAGACAGGAGAGGGG + Intronic
949384048 3:3480074-3480096 CCAGAATGAATGCCAGAGACTGG + Intergenic
949470371 3:4389723-4389745 GCAGAATGGAGGGCACAGAGGGG - Intronic
950184391 3:10936381-10936403 GCAGAAACAGGGCCACACAGTGG - Intronic
950437994 3:12992203-12992225 GGAGAACTGAGGCCAGAGAGAGG - Intronic
950654258 3:14426952-14426974 GCAGAACTAAAGCCAGAGAGGGG - Intronic
951222519 3:20083821-20083843 GCAGAAACAGGGCCAGCAAGAGG + Intronic
952558171 3:34557761-34557783 GCAGAATCAAGTACAGAGATGGG - Intergenic
952573234 3:34742833-34742855 GAAGAAACAAGCCCAGAGATGGG - Intergenic
953342464 3:42147110-42147132 GCACCATCATGGCCAGAGATAGG + Intronic
953393783 3:42550142-42550164 ACTGTATCAAGGCCAGAGTGTGG - Intronic
953830946 3:46297244-46297266 GTACAATCATGGCCAGAGAAAGG + Intergenic
954146866 3:48638834-48638856 GCAGGACCCAGGGCAGAGAGAGG - Intronic
954465480 3:50652119-50652141 GCTGAATTGAGGGCAGAGAGGGG - Intergenic
954625682 3:52020839-52020861 GCAGATTCCAGACAAGAGAGTGG + Intergenic
957066351 3:75525566-75525588 CCAGAATCAAAGCCAAAGTGTGG + Intergenic
958047130 3:88299008-88299030 GCAGAAACAAGACCAGTCAGAGG - Intergenic
959114811 3:102163980-102164002 GTAGAATCCTGGCCAGAGACGGG + Intronic
960853483 3:122079486-122079508 GCAAAAGCAAGCACAGAGAGTGG + Intronic
961038671 3:123661702-123661724 AAAGAAACAAGGCCAGGGAGAGG + Intronic
962330145 3:134471332-134471354 GCAGAGTCAATGCAAGGGAGAGG + Intergenic
962401187 3:135059963-135059985 CCAGAGTCAAGGCCAGGGAAGGG + Intronic
964818137 3:160739359-160739381 GCAGTCTCATGGCCACAGAGTGG + Intergenic
965269448 3:166594536-166594558 GCAGGACCAAGGTCTGAGAGGGG - Intergenic
966528553 3:180947137-180947159 GGAGAATCATGTCCAGAGGGTGG - Intronic
966735017 3:183181145-183181167 GCAGAGGCATGGCCAGAGGGCGG + Intronic
966940953 3:184746713-184746735 GTTGCATCAAGGCCAGAGTGTGG - Intergenic
967517430 3:190387025-190387047 GCAGAGAAAAGGCCAGAAAGAGG - Intronic
968941227 4:3639773-3639795 GAAGAAACAGGTCCAGAGAGAGG + Intergenic
969477469 4:7429702-7429724 CCTGAACCAAGGCCACAGAGTGG + Intronic
969554108 4:7894584-7894606 GCAGAATCAGGGAGACAGAGGGG + Intronic
970399774 4:15706004-15706026 GCAGGACCAAGGGCAGAGGGAGG + Intronic
970511283 4:16784293-16784315 GCAGAATGAGGTGCAGAGAGTGG - Intronic
977172766 4:93783407-93783429 TCAGAATCAAGGCGAGATGGAGG + Intergenic
981007857 4:139894038-139894060 ACAGAACCAATGCAAGAGAGGGG + Intronic
984742389 4:183178251-183178273 TTAAAATCAGGGCCAGAGAGTGG + Intronic
984765007 4:183393843-183393865 GCAGAATTAAGGCCAGACTTGGG - Intergenic
985562281 5:594473-594495 GCAGTATCAGGTCCAGAGAGAGG - Intergenic
987004016 5:13690554-13690576 ACAGAATGAAGCCCAGTGAGAGG + Exonic
988052503 5:26049229-26049251 GCAAAGACATGGCCAGAGAGAGG + Intergenic
988441300 5:31236707-31236729 GCACACTCAAGTTCAGAGAGAGG - Intronic
988919858 5:35930601-35930623 GCAGAACCAAGACTAGAGTGGGG - Intronic
990641124 5:57784682-57784704 ACAGCACAAAGGCCAGAGAGAGG + Intergenic
991052474 5:62287862-62287884 GAAGAATCAAGCCAAGGGAGGGG + Intergenic
992133975 5:73723895-73723917 CCAGAATCTACTCCAGAGAGTGG - Intronic
994127006 5:96179336-96179358 GGAGAAGAAAGGACAGAGAGAGG - Intergenic
995096998 5:108248342-108248364 GCAGAATGAAGGCAAGACAGAGG + Intronic
995500588 5:112801326-112801348 GCAGAATGAAGGTCAAGGAGTGG + Exonic
996134760 5:119827192-119827214 GATGAATCAAGGGCAGAGATAGG - Intergenic
997254877 5:132420766-132420788 GCAGAGGCATGGACAGAGAGAGG + Intronic
997284202 5:132666766-132666788 GCAGAGTCCAGGCATGAGAGAGG - Intergenic
998760733 5:145429149-145429171 GCAGAAGCAAGGATAGAGATGGG + Intergenic
999187118 5:149719717-149719739 TCAGAATCAAGCCAACAGAGAGG + Intergenic
999191342 5:149749763-149749785 GGAAACTCAGGGCCAGAGAGGGG - Intronic
999438408 5:151582126-151582148 GCAGAGCCAAGGCACGAGAGAGG + Intergenic
999847768 5:155504376-155504398 GGAGAATGGAGGCCAGAGAGAGG + Intergenic
1001080444 5:168663483-168663505 GCAGCATAAAGGCCTGAAAGAGG - Intronic
1001212864 5:169826989-169827011 TCAGAATCCAGGACAGAGCGTGG + Intronic
1001586678 5:172837655-172837677 GCAGATTCAAGGGTGGAGAGGGG - Intronic
1001857078 5:175022195-175022217 GCAGAATCTAGATCACAGAGGGG + Intergenic
1002315208 5:178338894-178338916 GCTGAATGAAGGCCAGAGACAGG + Intronic
1002339396 5:178505068-178505090 GCAGGATCAAGGCATCAGAGGGG + Intronic
1002522286 5:179798441-179798463 GCAGAATCAAGGGCTGAGGCAGG + Intronic
1003640654 6:7872504-7872526 TAAGGATCAGGGCCAGAGAGAGG - Intronic
1004429774 6:15533066-15533088 GCAAAAGCAGGGCAAGAGAGAGG + Intronic
1006077918 6:31546216-31546238 GCAGAAGAAAGGACAGTGAGTGG + Intronic
1006304310 6:33209838-33209860 GCTGAACCAAGACCAGTGAGAGG - Intronic
1006315997 6:33292126-33292148 CCAGGATCAAGGCCACAGGGAGG - Exonic
1006459875 6:34152135-34152157 GTAGAACCAAGGCTAGAGTGTGG - Intronic
1006912917 6:37575799-37575821 GCAGATACAAGGACAGAGAAGGG + Intergenic
1007143587 6:39603382-39603404 GCTGAATCAGTGCCAGGGAGAGG - Intronic
1008432647 6:51437100-51437122 GCAGTAGCAGAGCCAGAGAGTGG + Intergenic
1009660236 6:66602143-66602165 GCAGCATCAAGTAAAGAGAGTGG + Intergenic
1009848510 6:69164991-69165013 GCAGAATAAAGGTCTGAGGGAGG - Intronic
1010877733 6:81128476-81128498 GCTGAATCAAAAACAGAGAGTGG + Intergenic
1011456654 6:87557788-87557810 GCAGAGTCAAGGGCAGATGGTGG - Intronic
1011826529 6:91312552-91312574 TCAGCATCACGGCCAGATAGTGG - Intergenic
1012541571 6:100367609-100367631 GCAGACTTTAGGGCAGAGAGAGG + Intergenic
1013092512 6:106912888-106912910 GGACAATCAAGGCCAGACAGTGG - Intergenic
1013354500 6:109335296-109335318 GCTGGAGAAAGGCCAGAGAGGGG - Intergenic
1013392791 6:109703689-109703711 GCAGTCTCAGGGACAGAGAGGGG - Intronic
1014042699 6:116848417-116848439 GCAGAAGCAAGAAGAGAGAGTGG - Intergenic
1014988427 6:128042545-128042567 GCAGAATCAAAGGCAGAGAAGGG - Intronic
1015454366 6:133408959-133408981 GCAAAATCAAGTCTAGTGAGTGG - Intronic
1016290888 6:142527085-142527107 GCTGACACAAGGCCACAGAGAGG - Intergenic
1017147572 6:151248491-151248513 GCTGAATAAGGGCCAGGGAGAGG + Intronic
1017576574 6:155811627-155811649 GCAAATAGAAGGCCAGAGAGAGG - Intergenic
1018796782 6:167191958-167191980 GCAGAATCAAGGCCGCTGTGGGG + Intronic
1018819539 6:167363155-167363177 GCAGAATCAAGGCCGCTGTGGGG - Intronic
1018954660 6:168400698-168400720 GCAGGATGAATGCCAGAAAGTGG - Intergenic
1019339616 7:502713-502735 GCCCAGTCCAGGCCAGAGAGGGG + Intronic
1019705072 7:2493754-2493776 GCAGGATGAGGCCCAGAGAGGGG - Intergenic
1019937559 7:4266445-4266467 GCAGAAGCCAGGACAGAGGGAGG - Exonic
1021561353 7:21971796-21971818 GCAGAAACAAGGCCCTGGAGAGG + Intergenic
1021698176 7:23293591-23293613 GCTGGACTAAGGCCAGAGAGAGG - Intergenic
1022023396 7:26423164-26423186 CCAGAAAGCAGGCCAGAGAGAGG - Intergenic
1022093464 7:27123386-27123408 GCAGAATCAAGGCATCAGATCGG - Intronic
1022893882 7:34729313-34729335 GCATATTCAATCCCAGAGAGGGG + Intronic
1026490792 7:70861603-70861625 CCAGATTCAAGGACAGAGAATGG - Intergenic
1027230141 7:76267688-76267710 GCAAACTGAAGGCCAGAGGGGGG + Intronic
1028742909 7:94296980-94297002 GCAGAGTAAAGGCCAGCGATTGG - Intergenic
1031053787 7:116972115-116972137 GCAGAGTCAGGGTCAGAGGGAGG + Intronic
1031573989 7:123393741-123393763 AGTGAATTAAGGCCAGAGAGGGG - Intergenic
1031922012 7:127609149-127609171 GCAGGAGAAAGGCCAGAGGGAGG - Intergenic
1032311163 7:130788618-130788640 TCAGAAACAAGGCAAGAGTGAGG - Intergenic
1032504321 7:132424257-132424279 GCAAAACCCAGGCCAGGGAGCGG - Intronic
1035776984 8:2195936-2195958 TCAGAATCAAGCCTAGAGAGAGG + Intergenic
1036587593 8:10138797-10138819 GCAGAACTAAGGCCAAAGGGTGG + Intronic
1038570809 8:28660731-28660753 TGAGAATCAAAGGCAGAGAGTGG - Intronic
1040103923 8:43528800-43528822 GGACAATGAAGGCCAGAGTGAGG + Intergenic
1040298786 8:46177209-46177231 GCAGAAACAAGGCCACAGCGTGG + Intergenic
1040299570 8:46180885-46180907 GCAAAAACAAGGCCACAGGGTGG - Intergenic
1040299713 8:46181535-46181557 GCAAAAACAAGGCCACAGTGTGG - Intergenic
1040310893 8:46236289-46236311 GCAGAAACAGGGCCGCAGAGTGG + Intergenic
1040316467 8:46263506-46263528 GCAGAAACAGGGCCACAGGGTGG + Intergenic
1040329733 8:46379722-46379744 GCAGAAACAAAGCCACAGGGTGG + Intergenic
1041348264 8:56923652-56923674 GTAGAATGGCGGCCAGAGAGAGG - Intergenic
1041353929 8:56979655-56979677 TAAGAAACAAGGCCTGAGAGGGG + Intronic
1042792431 8:72623404-72623426 GCAGCATCAAGGACAGAGTGGGG + Intronic
1044812627 8:96079610-96079632 GCAGACTGCAGGCCAGAGACTGG - Intergenic
1045297847 8:100887977-100887999 ACGGAATGAAGGGCAGAGAGAGG + Intergenic
1045922966 8:107554178-107554200 GCAAAGTGAAGGCCAGAGTGAGG - Intergenic
1048215668 8:132492297-132492319 GCAGAGTTAAGGTCAGAGAGAGG + Intergenic
1048441514 8:134462774-134462796 GCAGATTCAAGACCAGACAAAGG + Intergenic
1048496818 8:134942401-134942423 GGAGAATCAAGGCAGGACAGAGG - Intergenic
1049755157 8:144308177-144308199 CCTGAAGCAGGGCCAGAGAGGGG - Intronic
1049973560 9:841784-841806 GCAGTCTCCAGGCGAGAGAGGGG + Exonic
1053473008 9:38360119-38360141 GGGGAAACAAGTCCAGAGAGGGG - Intergenic
1055246844 9:74256762-74256784 GCAGAATAAAGCCCCAAGAGTGG - Intergenic
1056454212 9:86744829-86744851 GGAGCAGCAAGGCCAGAGAAGGG - Intergenic
1057444750 9:95105682-95105704 GAAGAGTCAAGTCCAGGGAGAGG - Intronic
1057461373 9:95265715-95265737 GTAGAATCAAGGAGAGAAAGAGG - Intronic
1058254776 9:102748310-102748332 GCAGAATTAAGGGGATAGAGAGG + Intergenic
1059072497 9:111153198-111153220 TCAGAGTTAAGGCCAGATAGTGG + Intergenic
1059147166 9:111910455-111910477 CCAGAATGCAGCCCAGAGAGAGG - Intronic
1059455443 9:114397730-114397752 GGAGAATGAGGTCCAGAGAGGGG - Intergenic
1059485567 9:114624142-114624164 GCAGAATTAAGGCCAGAGGGAGG - Intronic
1060396210 9:123318767-123318789 GCAAGAAAAAGGCCAGAGAGCGG + Intergenic
1060731482 9:126039661-126039683 GCAGGTTCAAGGCCAGCCAGAGG + Intergenic
1060867719 9:127013253-127013275 ACAGAACCAAGGCCATAGTGGGG - Intronic
1060875560 9:127081322-127081344 GCAGAGGCAAGGGCAGAGGGTGG - Intronic
1060911271 9:127352956-127352978 GCAGAATCAGGGCAAGGCAGAGG - Intronic
1061034556 9:128106417-128106439 GGAGGATCCTGGCCAGAGAGGGG + Exonic
1061408534 9:130405849-130405871 GGAGCATCCAGCCCAGAGAGGGG - Intronic
1062205419 9:135334087-135334109 AGAAAATTAAGGCCAGAGAGAGG + Intergenic
1062275331 9:135727724-135727746 GGAGAATCCAGGCCAGCGAGTGG - Intronic
1062559696 9:137135920-137135942 GCAGAATAAAAGGCAGAGTGTGG - Intergenic
1185490912 X:516370-516392 GCAGAAACACAGACAGAGAGGGG - Intergenic
1185995587 X:4944713-4944735 GCAGAAGCAAGGCTAGAGCTTGG - Intergenic
1186794223 X:13029053-13029075 GCAGGAGAAAGGCCAGAAAGTGG + Intergenic
1187423979 X:19160859-19160881 GCAGTGTCCAAGCCAGAGAGTGG - Intergenic
1187565780 X:20448158-20448180 GCAGAATGAACACCAGAGTGGGG + Intergenic
1189013290 X:37069779-37069801 GCACAAACAAGCCCAGACAGTGG - Intergenic
1189147540 X:38670828-38670850 GCAGCACCAATGCCAGTGAGTGG + Intronic
1189536567 X:41941151-41941173 GCAGAGTCTGGGCCAGAGAGGGG - Intergenic
1191860839 X:65665756-65665778 GGAAACTCAAGCCCAGAGAGGGG + Intronic
1192467596 X:71368251-71368273 GCAGAAACAATGGCAGACAGCGG - Intronic
1192709661 X:73566672-73566694 GCAGAATCCAGATCAGAGAGGGG - Intronic
1192787051 X:74345955-74345977 GCAGCCTCAAGGTGAGAGAGAGG - Intergenic
1194057203 X:89150447-89150469 GCAAAATCAGAGACAGAGAGAGG + Intergenic
1195614796 X:106903606-106903628 GGAGTAGCAAGGCCTGAGAGGGG + Intronic
1196400064 X:115306240-115306262 GAAGAATCAAGGCCAGTCAGAGG + Exonic
1196623100 X:117846641-117846663 GCAGAAACTAGGGCACAGAGAGG + Intergenic
1196735481 X:118977628-118977650 GGAAAATCAAGCCCAGAGAAGGG - Intronic
1197590513 X:128403874-128403896 GGAGAATGAAGGCAAGAGGGTGG + Intergenic
1197597721 X:128486758-128486780 GCAGAATAAAGGCTACAGAGAGG + Intergenic
1198080064 X:133231400-133231422 GGATAATAAAGTCCAGAGAGTGG - Intergenic
1199690632 X:150306580-150306602 GCAGAGTGAGGGCCAGAGTGAGG - Intergenic
1199741337 X:150739232-150739254 AGGGAATCAAGGCAAGAGAGGGG - Intronic
1200918742 Y:8594270-8594292 GCAGTAATAAGGTCAGAGAGGGG + Intergenic
1200923204 Y:8631352-8631374 GCAGCAATAAGGCCAGATAGGGG + Intergenic
1200931091 Y:8697806-8697828 GCAGAAATAAGGTCAGATAGGGG - Intergenic
1202267979 Y:23040884-23040906 GCAGAATTCAGGCAGGAGAGGGG - Intergenic
1202420971 Y:24674628-24674650 GCAGAATTCAGGCAGGAGAGGGG - Intergenic
1202449815 Y:24995454-24995476 GCAGAATTCAGGCAGGAGAGGGG + Intergenic