ID: 1132057798

View in Genome Browser
Species Human (GRCh38)
Location 15:98665339-98665361
Sequence AGGCAGATGCAGAGTCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 581
Summary {0: 1, 1: 0, 2: 9, 3: 53, 4: 518}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132057798_1132057804 8 Left 1132057798 15:98665339-98665361 CCCTCCTGACTCTGCATCTGCCT 0: 1
1: 0
2: 9
3: 53
4: 518
Right 1132057804 15:98665370-98665392 AGCATCCTCCTCCAGTAAGTGGG 0: 1
1: 0
2: 2
3: 12
4: 155
1132057798_1132057803 7 Left 1132057798 15:98665339-98665361 CCCTCCTGACTCTGCATCTGCCT 0: 1
1: 0
2: 9
3: 53
4: 518
Right 1132057803 15:98665369-98665391 AAGCATCCTCCTCCAGTAAGTGG 0: 1
1: 0
2: 0
3: 12
4: 118
1132057798_1132057807 16 Left 1132057798 15:98665339-98665361 CCCTCCTGACTCTGCATCTGCCT 0: 1
1: 0
2: 9
3: 53
4: 518
Right 1132057807 15:98665378-98665400 CCTCCAGTAAGTGGGTCATTTGG 0: 1
1: 0
2: 0
3: 5
4: 82
1132057798_1132057809 25 Left 1132057798 15:98665339-98665361 CCCTCCTGACTCTGCATCTGCCT 0: 1
1: 0
2: 9
3: 53
4: 518
Right 1132057809 15:98665387-98665409 AGTGGGTCATTTGGATTCCAAGG 0: 1
1: 0
2: 1
3: 7
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132057798 Original CRISPR AGGCAGATGCAGAGTCAGGA GGG (reversed) Intronic
900157514 1:1209142-1209164 AACCAGCTGCAGAGGCAGGAGGG + Intergenic
900228281 1:1543060-1543082 AGGCAGAGGCAGAGGCGGGACGG + Intronic
900583692 1:3422317-3422339 AAGCAGATGGACAGGCAGGAAGG + Intronic
900837612 1:5017808-5017830 AGGTAGATGCAGAGTGAGTGAGG + Intergenic
901533164 1:9866264-9866286 AGGCAAATGCAGTGGCAGAAAGG + Intronic
901560586 1:10067126-10067148 AGGCAGAAGCTAAGACAGGATGG - Intronic
902185231 1:14719983-14720005 AGGGAGAGGCAGGGACAGGAGGG + Intronic
902554849 1:17240834-17240856 AGGCTGGTGCAGAGGCTGGAGGG + Intronic
902608018 1:17580055-17580077 AGGAAGAGGCAGAGTCAGAGTGG + Intronic
902705361 1:18200532-18200554 TGGCAGAGGCAGAGACCGGAGGG - Intronic
902805313 1:18857660-18857682 AAGCAGATCCAGAATGAGGAAGG + Intronic
902999281 1:20253272-20253294 TGGCAGAAGCAGAGTAAAGAGGG + Intergenic
903007541 1:20308657-20308679 AGGCAGATAAAGAGCCGGGAGGG - Intronic
903025854 1:20429491-20429513 GGGCAGATGCAAAGCCAGGGTGG - Intergenic
903479335 1:23641704-23641726 AGACAGAAGCAGAGACTGGAGGG - Intergenic
903560672 1:24224749-24224771 TGGCAGGTCCTGAGTCAGGAAGG + Intergenic
903925054 1:26826305-26826327 AGGCATTTGCAGAGGCAGGCAGG - Intergenic
904203204 1:28835230-28835252 AGCCAGAAGCAGAGCCAGGGTGG + Intronic
904403292 1:30270784-30270806 AAAGAGATGCAGAGTCAGGTAGG - Intergenic
904459160 1:30665244-30665266 AGGGAGGTGCAGAGACAGCAAGG + Intergenic
904894107 1:33801192-33801214 AGAGAGATGGAGAGTGAGGATGG - Intronic
905033059 1:34900388-34900410 AGGTACATGCAGAGGCAGAAGGG + Intronic
905276064 1:36819021-36819043 AGTCAGATGCAGAGACAGCAGGG - Intronic
905522889 1:38613920-38613942 AGGCAGAAGCAAGGTCAGTAGGG - Intergenic
905941087 1:41864062-41864084 GGGAAAATGCAGAGCCAGGAGGG - Intronic
906193028 1:43910898-43910920 AGGAATATGCAGAGCCAAGAGGG + Intronic
906956233 1:50377158-50377180 AGGCAGAGGCAGAATTATGAAGG + Intergenic
907373590 1:54018268-54018290 AAGCAGAGGCAAAGGCAGGAGGG + Intergenic
907467653 1:54650000-54650022 AGGCAGATGCAGAGCTATGCAGG + Intronic
907472071 1:54680413-54680435 AGCTGGAGGCAGAGTCAGGACGG - Intronic
907472564 1:54683500-54683522 GGGCAGGAGCAGAATCAGGAAGG - Intronic
907477470 1:54715272-54715294 GGGCTGAAGCAGAGTGAGGAAGG - Intronic
907555054 1:55336156-55336178 AGGCAGAAGAAGGGGCAGGAGGG + Intergenic
908171587 1:61510595-61510617 AGTCAGCTGCAGAGTCAGCTAGG + Intergenic
908741465 1:67333144-67333166 AGGGAGATTCAGAGACAGAAAGG - Intronic
910074479 1:83261222-83261244 TAGCAGGTGCAGAGTCAAGAAGG - Intergenic
910152886 1:84174125-84174147 AAGCAGATGCCGAATCAGGGAGG - Intronic
910344912 1:86225490-86225512 AGGCAGCTCCAGAGGCAAGAGGG + Intergenic
912493866 1:110078753-110078775 GGGCAGATGGAGAGGCAGGCAGG + Intergenic
912550623 1:110483203-110483225 AGGCAGGTGCAGGGTTGGGATGG - Intergenic
915732868 1:158066641-158066663 AGGCAGGTGCAGGGCCTGGATGG + Intronic
915733663 1:158071255-158071277 AGGCAGAGGGAGAGCGAGGAGGG - Intronic
916084814 1:161260719-161260741 ATTCAGCTGCTGAGTCAGGAGGG - Intronic
916456104 1:164972443-164972465 AGGCAGCAGCAGAGGCAGAAGGG - Intergenic
916479387 1:165201501-165201523 AGGCAGATGCCTAGCCAGGATGG - Intergenic
917513853 1:175690603-175690625 AGGCAGGTGCAGAGCTAGGCAGG + Intronic
918290184 1:183099896-183099918 AGGCAGGCGCAGGGGCAGGATGG - Intronic
919521673 1:198597121-198597143 AGACAGATGCAGATTTATGAGGG - Intergenic
919804310 1:201371993-201372015 AGGCAGGTGGAGAGCCAGAAAGG - Intronic
919930117 1:202215646-202215668 AGACAGATTCTGAGGCAGGAGGG - Intronic
920273031 1:204781310-204781332 AGTCAGATGTAGAGTCATGAAGG + Intergenic
920458259 1:206117134-206117156 AGGAAGATGGGGAATCAGGACGG + Exonic
922691484 1:227695540-227695562 AGGCAAAGGCAGAGTCATGGAGG - Intergenic
922772794 1:228196992-228197014 AGACAGAGGCAGAGACTGGAGGG - Intergenic
924623891 1:245684927-245684949 AGGCAGAGGCCAAGCCAGGATGG + Intronic
1062961852 10:1578212-1578234 TGGCACGTGCAGAGGCAGGAGGG + Intronic
1062982526 10:1737185-1737207 AGGCAGGTGCAGGTGCAGGAGGG - Exonic
1063149044 10:3320389-3320411 AGGCAGTTGCTGAGGCGGGAGGG + Intergenic
1063223482 10:3992746-3992768 AGGCAGGTGCAGAGGCAGCCTGG + Intergenic
1064997661 10:21310662-21310684 AGGCAGATGGTGAGCCAAGATGG + Intergenic
1065201337 10:23316144-23316166 AGCCAGATGCAGAGTGACAAGGG + Intronic
1065915941 10:30355110-30355132 AGGAAGCTGCAGAGGCAGGCAGG + Intronic
1066139554 10:32489718-32489740 AGGCTGGTGCAGAGTGAGCATGG + Intronic
1066444479 10:35469534-35469556 AGGAAGATGGAGAGGCAGAACGG + Intronic
1067181214 10:43987266-43987288 AGGCAGTTGCACACCCAGGAGGG + Intergenic
1067526507 10:47042494-47042516 TTGCAGATTCAGTGTCAGGAGGG + Intergenic
1067826874 10:49581531-49581553 AAACAGATTAAGAGTCAGGATGG + Intergenic
1068345877 10:55777052-55777074 AGGCTAATGCAGAAGCAGGAAGG + Intergenic
1069720117 10:70544494-70544516 AGGCAGGAGCTGAGTGAGGAGGG + Intronic
1069906316 10:71734629-71734651 AGGCAGAGGCAGCAGCAGGAGGG - Intronic
1070167031 10:73906694-73906716 AGGCAGAAAAAGAGTGAGGAAGG + Intergenic
1070276064 10:75008147-75008169 ATGGTGATGCAGAGTGAGGATGG + Intronic
1070697014 10:78570983-78571005 TGAGAGGTGCAGAGTCAGGAAGG - Intergenic
1071178587 10:82956449-82956471 AGGCAGAGGCAGGCTCAGAATGG + Intronic
1071416002 10:85441834-85441856 AGGGAGATGCAGAGACAGCAGGG - Intergenic
1072034410 10:91551323-91551345 AGGCAGATGATTATTCAGGATGG - Intergenic
1073103553 10:101019523-101019545 AGGCAGAAGCAGAAGCAGAAGGG - Intronic
1073290863 10:102412623-102412645 AGGCAGAAGGAGGGTCTGGATGG - Intronic
1074161679 10:110841087-110841109 AGGCTGTGGCAGAGTCAGGCAGG - Intergenic
1074320179 10:112394504-112394526 AGGCAGACCAAGGGTCAGGAAGG - Intronic
1074354945 10:112774251-112774273 AGGCTGATGCAGAGACACAAAGG + Intronic
1074532185 10:114305411-114305433 AAGGAGATGCAGATGCAGGAGGG + Intronic
1074532235 10:114305603-114305625 AAGGAGATGCAGATGCAGGAGGG + Intronic
1074532366 10:114306085-114306107 AAGGAGATGCAGATGCAGGAAGG + Intronic
1074979153 10:118605453-118605475 ACGGAGATGCTGAGTCAGGCAGG - Intergenic
1075345591 10:121679740-121679762 AGGGAGAGGCAGACTGAGGAGGG - Intergenic
1075976249 10:126698109-126698131 ATGCAGAGGAAGAGTCTGGATGG - Intergenic
1076080261 10:127573733-127573755 ATGCAGATCCAGAATCAGAAAGG + Intergenic
1076235189 10:128858652-128858674 AGGCAGATGTAGGGGTAGGAAGG + Intergenic
1077190406 11:1253707-1253729 AGGCAGAGGCAGAGATCGGAGGG - Intronic
1077608584 11:3628818-3628840 ATGCAGGGGCAGAGGCAGGATGG + Intergenic
1078108113 11:8371320-8371342 AGACAGAGGCAGAGACTGGAGGG + Intergenic
1078767578 11:14313661-14313683 AGGCAGAGGCAGAGATTGGAGGG + Intronic
1079467919 11:20749745-20749767 GGGTAGATGAAGTGTCAGGAAGG - Intronic
1079780912 11:24603245-24603267 AGTCAGATGCAACGGCAGGATGG - Intronic
1079837475 11:25351565-25351587 AGGCAAATGCAGAGTCCTGGGGG - Intergenic
1080126165 11:28736471-28736493 AAACAGAGGCAGAGTCATGAAGG + Intergenic
1080379778 11:31756324-31756346 AGGCAGAGGCAGAATCTGTAGGG - Intronic
1081192881 11:40126178-40126200 ATGAAAATGCAGAGTCAGGTGGG - Intronic
1081495193 11:43602096-43602118 AGAAAGATCCAGAGTCAAGAGGG - Intronic
1081694437 11:45099992-45100014 AGGCAGGTGCAGTGACAGCAGGG + Intronic
1082809178 11:57468197-57468219 ATGGAGATGCTGAGGCAGGAAGG - Intronic
1084919376 11:72456977-72456999 TGGCAGATGCAGAATCTTGATGG - Intergenic
1085029378 11:73260359-73260381 AGGGAGCTGGGGAGTCAGGAGGG + Intergenic
1085632688 11:78132383-78132405 AGGCAGAAGGAGAGTCAGGAAGG - Intronic
1086061974 11:82709072-82709094 ACGCAGGTGAAGGGTCAGGAAGG - Intergenic
1086177640 11:83911199-83911221 GGGCAGAGGCAGAGAGAGGAAGG + Intronic
1086587931 11:88477604-88477626 AGGCGGAGGCAGAGGCAGAAAGG + Intergenic
1087093503 11:94298984-94299006 AGGCAGCTGAAGGGTCAGGTAGG + Intergenic
1087347056 11:96984775-96984797 AGACAGATGGACAGTCAGGAAGG + Intergenic
1087624940 11:100585477-100585499 AAGCAGAGGCAGAGAGAGGATGG - Intergenic
1088810613 11:113389095-113389117 AGGCAGATGTTGAGGGAGGAAGG - Intronic
1089479989 11:118796840-118796862 AGGCAGATGAAAAGCAAGGAGGG - Intergenic
1089495595 11:118907324-118907346 AGGCAGTTGCAGTGTAGGGAGGG + Intronic
1089556365 11:119317633-119317655 AGGCTGAGGCAGTGTCAGGCCGG - Intronic
1089562638 11:119352309-119352331 TGTCAGAAGCAGAGACAGGATGG - Intergenic
1091268598 11:134289928-134289950 AGGCAAGGGCGGAGTCAGGACGG - Intronic
1091287169 11:134413855-134413877 GGGCAGGTGCAGAAGCAGGATGG + Intergenic
1091705962 12:2693551-2693573 AGGCTGCTCCAGAGTGAGGAAGG - Intronic
1091951448 12:4596355-4596377 AGGGAGAGGCACAGTCAGGAAGG - Intronic
1092926860 12:13279354-13279376 AGGCAGATGGAGAAAGAGGAAGG - Intergenic
1092941061 12:13407633-13407655 AGACAGAGGCAGAGACTGGACGG - Intergenic
1093529476 12:20143938-20143960 AGGGTGATGCAGAGTCCAGATGG + Intergenic
1095934008 12:47657283-47657305 AGGCAGATGCAGGGAAAGCATGG - Intergenic
1096529961 12:52236266-52236288 AGACAGGTGCAGAGTAGGGAAGG + Intronic
1096863114 12:54544323-54544345 ATGCAGATGCAGATGGAGGAGGG - Exonic
1098041958 12:66361724-66361746 AAGCAGAGGCTGAGTCAGGAGGG - Intronic
1098749268 12:74274624-74274646 TGGGTGATGCAGATTCAGGAGGG + Intergenic
1099051257 12:77783983-77784005 AGGGAGAAGCAGAGTCATGATGG - Intergenic
1099389453 12:82061397-82061419 AGTCAGAAGCACAGTCAGGCTGG + Intergenic
1099556330 12:84112242-84112264 AGAAAGCTGCAGAATCAGGAAGG - Intergenic
1100534355 12:95492751-95492773 AGTCAGAGACAGAGTCAGGTTGG + Intronic
1100777880 12:97992220-97992242 AGGCAGAGACAGAGGCAGAATGG - Intergenic
1101084080 12:101217434-101217456 AGGCAGAGGCAGACCCAGAATGG + Intergenic
1101201198 12:102438190-102438212 AAGCTGAGGCAAAGTCAGGAAGG + Intronic
1102243651 12:111341607-111341629 ATGCAGAAGGAGAGTGAGGAGGG + Intronic
1102514143 12:113435288-113435310 AGGGAGAAGCAGAGTGAGGGAGG - Intronic
1102682231 12:114698626-114698648 AGGGAGATGGAGAGAGAGGAGGG - Intergenic
1103041641 12:117700644-117700666 AAGCACATACAGAGGCAGGAAGG - Intronic
1104285058 12:127417657-127417679 AAGCAGAAGGAAAGTCAGGAAGG - Intergenic
1104418761 12:128617595-128617617 GGGCAGATGCAGAGTCAGGTGGG + Intronic
1104418777 12:128617658-128617680 GGGCAGGTGTAGAGTCAGGTGGG + Intronic
1104426584 12:128682975-128682997 AGGCAGACGCACAGGGAGGACGG - Intronic
1104427484 12:128690032-128690054 AGGCAGGTGCAGACTCAGGAAGG + Intronic
1104483657 12:129130409-129130431 AGGGAGGGGCAGAGTCAGGATGG - Intronic
1104812850 12:131628889-131628911 CAGCAGGTGCAGAGTGAGGAGGG - Intergenic
1104886408 12:132111819-132111841 AGGGAGATGCAGATGCAGGTGGG + Intronic
1106059232 13:26270578-26270600 AGGCAAATGCAGGGACAGAAAGG - Intronic
1106169090 13:27273228-27273250 CGGCAGGTGCAGACACAGGACGG + Exonic
1106253386 13:28001158-28001180 AGCCAGGCGCAGAGCCAGGAGGG + Intergenic
1107354056 13:39546967-39546989 AGGCAGAGGCAGAGTCTGAAAGG - Intronic
1107566351 13:41609277-41609299 AGGCATATGCAGAATGAGGTCGG - Intronic
1107753883 13:43598582-43598604 AGGCATGTGCAGAGACTGGAGGG - Intronic
1108456763 13:50623128-50623150 AACCAGATGCAGATTCAGGGTGG - Intronic
1108485041 13:50915331-50915353 AGGCAGACACAAAGTCAAGACGG - Intronic
1108556836 13:51601720-51601742 AGGAAGAGGCAGAGTGGGGAAGG + Intronic
1109470086 13:62792390-62792412 AGACAGAGGCAGAGACTGGAGGG + Intergenic
1109587190 13:64421889-64421911 AAGCAGATGAAGAGTCAGAAAGG + Intergenic
1110233711 13:73194257-73194279 GCACAGATGCAGAGACAGGAAGG - Intergenic
1110568273 13:76977914-76977936 ATGCAGATGCAGATACAGGCTGG + Intergenic
1110761326 13:79233723-79233745 AGGCAGTTGCAGGACCAGGAAGG - Intergenic
1112409106 13:99146782-99146804 AGACAGACGCAGAGGCGGGAGGG - Intergenic
1112697436 13:101966382-101966404 AGGCAAATACAGACTCTGGAGGG + Intronic
1113138252 13:107117584-107117606 AGGCAGGCGCAGAGCCGGGAGGG + Intergenic
1113401583 13:109999166-109999188 AGGCAGATGATGAGAGAGGACGG - Intergenic
1113702763 13:112399430-112399452 AGGCAGATGCCAAGACAGGGAGG + Intronic
1113775528 13:112943037-112943059 ATGGAAATGCAGAGCCAGGAAGG + Intronic
1113942916 13:114027938-114027960 AAGCAGAGGCGGCGTCAGGAGGG + Intronic
1118588150 14:67376600-67376622 AGGTAGAAGGAGAGTCAAGAAGG - Intronic
1118757191 14:68853615-68853637 TGGCAGATGCAGTGTGATGAAGG - Intergenic
1119187087 14:72650688-72650710 AGGCAGATGGAGAGGCAGCATGG - Intronic
1119492256 14:75045627-75045649 AGGCACCTGCAGTGTCAGCATGG - Intronic
1119676892 14:76562540-76562562 AGGAAGAAGGAGAGCCAGGAGGG + Intergenic
1120461880 14:84807375-84807397 AGTCAGTCCCAGAGTCAGGATGG + Intergenic
1120929654 14:89835976-89835998 AAGAAGATGGAGAGTCAGGTTGG + Intronic
1121638326 14:95468630-95468652 AGGAAGGAGCAGGGTCAGGAGGG - Intronic
1122043627 14:99008159-99008181 GGGGAGAGGCAGAGGCAGGAGGG - Intergenic
1122048087 14:99037568-99037590 AGGGAGAGGGAGAGTCAGGTGGG + Intergenic
1122048321 14:99038877-99038899 AGGGAGAGGGAGAGTCAGGTGGG + Intergenic
1122271876 14:100571941-100571963 AGGGAGATGCAGCGGCAGAATGG - Intronic
1122274189 14:100582874-100582896 ACGCAGGCGCAGGGTCAGGAGGG - Intronic
1122314056 14:100815345-100815367 TGGCACACGCAGAGTCAGCATGG + Intergenic
1122648287 14:103209481-103209503 AAGCAGGTGGAGAGTCAGAAGGG - Intergenic
1122818067 14:104323804-104323826 AGGCAGATGGAGAGTCGGTTGGG + Intergenic
1122874494 14:104657414-104657436 AGGGAGAGGCAGGGTTAGGAGGG - Intergenic
1123685616 15:22795022-22795044 AGGGAGCCGCAGAGTGAGGATGG + Intronic
1123774531 15:23565832-23565854 AGGCAGGTGCTGAGGCAGCAAGG + Exonic
1125327847 15:38554918-38554940 AGTCAGTTGTAGTGTCAGGAAGG - Intronic
1126128943 15:45321893-45321915 AGGCAGTCACAGAGTCTGGAAGG - Intergenic
1127268146 15:57377254-57377276 CGGCATAAGCAGAGTCGGGAGGG - Intronic
1127318585 15:57819978-57820000 AGGCGGAAGCAGAGGCAGGTAGG - Intergenic
1128072786 15:64807852-64807874 GGGAAGGTGCAGAGTGAGGATGG - Intergenic
1128102569 15:65015201-65015223 AGGAAGTAGCAGAGTCAAGATGG + Intronic
1128253970 15:66183739-66183761 ATGCAGATTCTGAGTCAGGAGGG + Intronic
1128700346 15:69799422-69799444 AGGGAGACTCAGAGTCAGGGAGG + Intergenic
1128716050 15:69908821-69908843 AGGCAGGTGCAGAGCCTGGAAGG - Intergenic
1129518898 15:76173336-76173358 AGGCTTCTGAAGAGTCAGGAAGG + Intronic
1130685026 15:86029757-86029779 AGGAAAATGAAGAGGCAGGAGGG + Intergenic
1130706421 15:86237155-86237177 AGGCAGATACAGAGGAAAGAGGG - Intronic
1131178240 15:90223507-90223529 AGGCACATGCTGAGCCATGACGG - Intronic
1131670384 15:94613653-94613675 AGGCAGAACCAGAGTGAGAAAGG - Intergenic
1131679718 15:94708828-94708850 TGGAAAATGAAGAGTCAGGATGG + Intergenic
1132057798 15:98665339-98665361 AGGCAGATGCAGAGTCAGGAGGG - Intronic
1132568552 16:634273-634295 AGACAGCTGCTGAGGCAGGATGG - Intergenic
1134125334 16:11612425-11612447 AGGCAGGTGAAGAATGAGGAAGG + Intronic
1134596058 16:15496904-15496926 AGGCAGGGGCAGAGCCAGGCAGG + Intronic
1135965312 16:27030391-27030413 AGGCAGAAGCAGGGGCTGGAAGG + Intergenic
1136097008 16:27963847-27963869 ATGCAAAGGCAGACTCAGGATGG - Intronic
1136380254 16:29890651-29890673 GGAGAGATGTAGAGTCAGGAAGG - Intronic
1137934300 16:52619358-52619380 AGGCAGCTGCACGGTCATGAAGG - Intergenic
1138521087 16:57571201-57571223 TGGCTGATGCAGGCTCAGGATGG + Intronic
1139917027 16:70434856-70434878 AGGCAGATACAGACCCAGGTAGG - Intronic
1141605861 16:85152863-85152885 GGGCAGAGGCAGATTCAGGGAGG + Intergenic
1141764689 16:86050817-86050839 AGGCAGAAGCACTGCCAGGAGGG - Intergenic
1141954854 16:87363987-87364009 ACGCTGATGCAGAGCAAGGACGG + Intronic
1142255937 16:89013996-89014018 AGGCAGAGAAAGAGTGAGGAAGG + Intergenic
1142387046 16:89772113-89772135 AGGCAGATGTGGTGTCTGGAGGG - Intronic
1142592677 17:1013246-1013268 AGCCAGCTACACAGTCAGGAAGG + Intronic
1143020843 17:3916552-3916574 AGGCCCACGCAGAGCCAGGAGGG - Intergenic
1143115879 17:4581723-4581745 GAGCAGAAGCACAGTCAGGAAGG + Intergenic
1143764050 17:9126046-9126068 TTGCAGAAGCAGAGTCAGGATGG + Intronic
1144031820 17:11329924-11329946 AGGCAAATAGAGAGACAGGAGGG - Intronic
1144141711 17:12355807-12355829 AGGTAGATTCTGATTCAGGAGGG + Intergenic
1145793636 17:27643439-27643461 AGGCAGAGGCAGGGGCAAGAGGG - Intronic
1145898630 17:28475341-28475363 AGACAGGACCAGAGTCAGGATGG - Intronic
1146522523 17:33537149-33537171 TGGCAGAGGCTGAGTCAGAAAGG - Intronic
1147260749 17:39208708-39208730 AGGGAGATGCAGAAAGAGGAGGG - Intergenic
1147359289 17:39921163-39921185 TGGGAGATGCAGGGTCAGGAGGG + Intronic
1147759936 17:42791028-42791050 AGGTGGAGGCAGAGGCAGGAAGG - Intronic
1149089645 17:52762789-52762811 AGGTGGATGCTGAGTCAGGCAGG - Intergenic
1149573376 17:57693412-57693434 AGGCAGAGGCAGAGGCAGGTGGG - Intergenic
1150293062 17:63992969-63992991 TGGCAGGGGCAGAGTCAGGAGGG + Intergenic
1150299565 17:64036966-64036988 AGGCAAATCCTGAGTCTGGAAGG + Intergenic
1150587072 17:66528507-66528529 ATGCAGAAGCAGAGTTGGGAGGG + Intronic
1150914485 17:69422784-69422806 AGTCAGTGGCAGAGGCAGGATGG + Intronic
1151494195 17:74449746-74449768 AGGAAGGTCCAGAGTCAAGACGG - Intronic
1151557776 17:74855158-74855180 AGGCAGATGGACAGACAGGAGGG + Intronic
1151735051 17:75934489-75934511 AGGCAGAGGCAGAGCCGAGATGG + Intronic
1151768584 17:76145167-76145189 AGGCAGCAGCTGAGTGAGGATGG + Exonic
1152250231 17:79208653-79208675 AGGCAGAGGCAGAGGCAGAGGGG + Intronic
1152395558 17:80030761-80030783 GGGCAGAGGCAGAGGCAGGCAGG + Intronic
1152632461 17:81416702-81416724 AGGCAGGTGCAGGCTCGGGATGG - Intronic
1154269379 18:12906285-12906307 AGGCAGCTGCAGAGACAGGAAGG - Intronic
1155043577 18:22085095-22085117 GGGCAGAAGCAAAGGCAGGAGGG + Intergenic
1156492854 18:37506541-37506563 AGGCAGATGGAGAGGGAGGTTGG + Intronic
1157174238 18:45436760-45436782 AAGCAGAAGCTGAGTAAGGATGG + Intronic
1157235140 18:45958001-45958023 AGGCTGAGGCAGGGTCAGTATGG + Intronic
1157354263 18:46918231-46918253 AGGAAGATGCTGAGTCAAGATGG + Intronic
1157506392 18:48229778-48229800 AGGGAGATGGACAGTCAGGAAGG - Intronic
1157687868 18:49657361-49657383 AGGCAGCAGCAGGGTGAGGATGG - Intergenic
1158538214 18:58327491-58327513 AGGGAGAGGCTGAGCCAGGAAGG + Intronic
1158717899 18:59896824-59896846 AGGCATATGTAGAGTCAGCCTGG - Intergenic
1158813740 18:61069315-61069337 ATGCAGAAGCAGAGTATGGAAGG - Intergenic
1158907329 18:62026689-62026711 TAGCAGAGGCAGAGTCAGGAAGG - Intergenic
1159109676 18:64042391-64042413 AAGAAGATGGAGAGGCAGGATGG + Intergenic
1159870677 18:73757099-73757121 AGGCAGAGGCAGAGGCAGACAGG + Intergenic
1160374756 18:78403179-78403201 GAGCAGCTGCAGAGTCAGGCAGG - Intergenic
1160380143 18:78448373-78448395 AGGAAGATGGAAAGGCAGGAGGG - Intergenic
1160411896 18:78680835-78680857 AAGCAGGTGCAGAGACAGTAAGG + Intergenic
1160512602 18:79460981-79461003 CAGCAGATGCAGGGCCAGGACGG + Intronic
1160721844 19:600978-601000 AGGCCAATCCAGAGACAGGAAGG - Intronic
1160855065 19:1213466-1213488 AGGCCAATCCAGAGGCAGGAAGG - Intronic
1160931817 19:1574398-1574420 AGGCCGATTCAGAGACAGGAAGG - Intronic
1160953917 19:1680942-1680964 AGGCAGATGGGGAGGCTGGAAGG + Intergenic
1161046750 19:2139150-2139172 AGGCCAATCCAGAGACAGGAAGG + Intronic
1161057680 19:2198749-2198771 AGGCCCATCCAGAGACAGGAAGG - Intronic
1161163948 19:2775633-2775655 AGGCCCATCCAGAGACAGGAAGG + Intronic
1161330301 19:3683748-3683770 AGGCAGAGGCACAGCCAGTACGG + Intronic
1161352826 19:3803415-3803437 AGGCAGATGCAGGGTGGGGGCGG - Intergenic
1161352834 19:3803438-3803460 AGGCAGATGCAGGGTGGGGGAGG - Intergenic
1161409852 19:4111085-4111107 AGGCTGATCCAGAGACAGGAAGG + Intronic
1161539481 19:4841408-4841430 AGGCCCATCCAGAGACAGGAGGG + Intronic
1161572011 19:5035952-5035974 TGGCAGCTGCAGAGTCACGTTGG + Intronic
1161684804 19:5697487-5697509 AGGCTGAGGCAGAGGGAGGAGGG + Intronic
1161982949 19:7639340-7639362 AGGGAGCTGCACGGTCAGGAAGG - Intronic
1162185482 19:8901532-8901554 AGGGAGGTGCAGGGACAGGAGGG + Intronic
1162324964 19:9993499-9993521 AGGCAGATGGGGTGTGAGGAGGG + Intronic
1162835447 19:13314148-13314170 AGGAAGATGAGGAGTTAGGAAGG + Intronic
1163020760 19:14479819-14479841 AGGCAGCTGGAGACTCAGGCTGG - Intronic
1163087723 19:14994382-14994404 GGGCAGATGCAGAGAGGGGAGGG - Intronic
1163405498 19:17119516-17119538 TGGCAGTTCCAGAGTAAGGATGG - Intronic
1164592647 19:29514639-29514661 GGGCAGATGAAGAGGAAGGAGGG + Intergenic
1164633623 19:29777449-29777471 AGGCAGTGGCAGAGTCAGGTTGG - Intergenic
1165485428 19:36092640-36092662 AGGCAGAGGAAGAGTAAGCATGG - Intronic
1167056907 19:47117157-47117179 AGTCAGATGAAGTGTCAGAAGGG - Intronic
1167987118 19:53327978-53328000 AGGCAGATGCTGACCCAGGGAGG + Intergenic
1168238008 19:55075816-55075838 AGGCGGAGGCGGAGGCAGGACGG + Intronic
925122256 2:1428428-1428450 CGGCAGTTGCAGGGACAGGAAGG + Intronic
925325061 2:3012332-3012354 TGGCAGCTGCAGACCCAGGAAGG - Intergenic
926198609 2:10778064-10778086 GGGCAGCTGCAGTGTCAGGCGGG + Intronic
926686007 2:15698073-15698095 AGGCAGAGGCAGAGGCAGAATGG + Intronic
927332781 2:21885651-21885673 AAGGAGATGCAGTGACAGGAAGG - Intergenic
927667896 2:25044811-25044833 GGGCAGAGGCAGGGTGAGGAGGG - Intronic
927734560 2:25507662-25507684 AGACTAAAGCAGAGTCAGGATGG - Intronic
927829520 2:26337220-26337242 AGGCCAGTGCAGAGTCACGAAGG - Intronic
928126903 2:28623102-28623124 AGACAGATGCAGACCCAGAAGGG + Intronic
928912461 2:36436285-36436307 AGGAAGATGCAGGGTGAGTAGGG + Intronic
929123277 2:38500921-38500943 TGCCAGGTACAGAGTCAGGAAGG + Intergenic
929863799 2:45700837-45700859 AGGCAGATGCAGGGAGAGGGCGG + Intronic
930758686 2:55006951-55006973 AGTCAAATGCAGAGTGAGGCAGG - Intronic
931516463 2:63053099-63053121 AGGCTGAGGCAGGGTCGGGAGGG - Intronic
932446734 2:71786195-71786217 AGGCAGAGGCAGAGTAGGGTTGG + Intergenic
932468684 2:71940013-71940035 GGGCAGAAGCAGGGCCAGGAGGG - Intergenic
932487086 2:72090777-72090799 AGGCAGAGGAAGGGGCAGGAGGG - Intergenic
932688186 2:73891354-73891376 AAGACGAAGCAGAGTCAGGAAGG + Intergenic
934128198 2:88919889-88919911 AGGCAGAGGCAGAGGCAGTGAGG - Intergenic
934670271 2:96208212-96208234 AGGCAGAGGCATGGCCAGGACGG + Exonic
935191421 2:100781721-100781743 AGGCTGATGCAGCATCAGGCTGG - Intergenic
937114319 2:119393648-119393670 AGGCAGAGGCAGAACCTGGAAGG - Intergenic
937256633 2:120560590-120560612 AGGGAGATCCAGAGCAAGGATGG - Intergenic
937278820 2:120703591-120703613 ACTCAGCTGCAGAGTGAGGAAGG - Intergenic
938318265 2:130344906-130344928 AGCCAGGTGCAGAGTCAGTGAGG - Intronic
938380058 2:130831584-130831606 AGGCAGGGGAAGAGGCAGGAGGG - Intergenic
938801045 2:134763553-134763575 AGTGAAATGCAGAGTCATGAAGG - Intergenic
939850222 2:147295556-147295578 AGGTAGATGCAAAATCTGGATGG - Intergenic
940118643 2:150238511-150238533 AGGCAGAGGCAAAGGCTGGATGG + Intergenic
940251173 2:151678659-151678681 AGGGAGACCCAGAGCCAGGAGGG + Intronic
941920987 2:170850524-170850546 AGGTAGAAGCAGACTAAGGAGGG + Intronic
942058577 2:172207247-172207269 AGGATGAAGCAGAGTCAGGGAGG - Intergenic
942095996 2:172537156-172537178 AGGCAGAGGCAGAGGCAGAAAGG - Intergenic
942222454 2:173783940-173783962 AGGCAGATGCATTCACAGGAGGG + Intergenic
943848907 2:192690488-192690510 AGGCAGATGCAGAAATAGAATGG - Intergenic
944107619 2:196095939-196095961 AGACAGAGACAGAGTCAGGCTGG - Intergenic
944313041 2:198256716-198256738 GAGCAGATGGAGAGTCAGGGAGG - Intronic
945043494 2:205762311-205762333 AGGCAGCTGGGGAGTCAAGAAGG + Intronic
946487866 2:220118044-220118066 TGACAGATTCAGAGTGAGGAAGG - Intergenic
946860684 2:223997772-223997794 AGGCAGATGCAAAAGCAGGAAGG + Intronic
948068060 2:235096893-235096915 AGGCAGAGGCAGAGATTGGAGGG - Intergenic
948333985 2:237193653-237193675 AGGCAGGTGCAGACACAGGTAGG + Intergenic
948386123 2:237582107-237582129 AGGCAGGAGCAGAGGCAGAACGG - Intronic
948528500 2:238588185-238588207 AGACAGATGCAGAGAAGGGAAGG - Intergenic
948962393 2:241350115-241350137 ATGCAGATGCAGATGCAGGGCGG + Exonic
948990608 2:241552025-241552047 AGGAGGCTGCAGAGGCAGGAGGG + Intergenic
1168960001 20:1862447-1862469 TCCCAGATGCAGAGCCAGGATGG - Intergenic
1171339062 20:24412899-24412921 TGGCAGAGGCAGAGGCAGAAGGG - Intergenic
1172038570 20:32028036-32028058 ACTCAGCTGGAGAGTCAGGAGGG + Intronic
1173060023 20:39651817-39651839 AGCCAGAAGCAGAGTCAGCCAGG + Intergenic
1173247037 20:41344096-41344118 ATGCAGATGCTGATTCAGTAGGG + Intronic
1173350732 20:42243024-42243046 AGGCAGAGGCAGAGGCAGAAAGG + Intronic
1173544669 20:43885873-43885895 AGGCAAAGGCAGAATCAGGGAGG - Intergenic
1173696322 20:45017476-45017498 AGGCAGGTGCAAAGTCAGAAAGG + Intronic
1175499083 20:59436781-59436803 AGGGAGAGGCAGGGTCAGGAAGG + Intergenic
1175594744 20:60222001-60222023 AGACACATGCAGAGACCGGAGGG + Intergenic
1175604089 20:60298369-60298391 AGGCAGAGGCAGAGATGGGAGGG - Intergenic
1175801637 20:61804405-61804427 GGCCAGATGCAGAGGCTGGACGG - Intronic
1176078509 20:63260120-63260142 AGGCAGGTGCTGAGCCAGGTGGG - Intronic
1177624748 21:23645827-23645849 AGCCAGATGCAGAGTGGTGAGGG + Intergenic
1178345940 21:31828065-31828087 GGGAAGATGCAGAGGAAGGAAGG + Intergenic
1178431978 21:32525383-32525405 TGGCTGAAGCAGAGCCAGGAGGG + Intergenic
1179238548 21:39568387-39568409 AAGCAGCTGGAGAGGCAGGAGGG - Intronic
1179289447 21:40005950-40005972 GGGAAGAGGCAGGGTCAGGAAGG + Intergenic
1179786534 21:43733497-43733519 AGACAGATGGAGAGGAAGGACGG - Intronic
1180742814 22:18065492-18065514 AGGCAGAGGCGGGGGCAGGAGGG + Intergenic
1181543008 22:23583997-23584019 TGGCAGGTGCAGGGTCAGGCAGG - Intergenic
1181613449 22:24035392-24035414 AGGCCTATGAAGAGCCAGGAAGG - Intronic
1182306833 22:29375644-29375666 AGGCTGATGCAATGTCAAGATGG + Intronic
1182743286 22:32584474-32584496 TGTTAGATGCAGTGTCAGGATGG + Intronic
1182786397 22:32911431-32911453 AGGCAGGAGAAGAGTCAAGATGG - Intronic
1183103924 22:35602460-35602482 AGTCCCAGGCAGAGTCAGGAGGG + Intergenic
1183704967 22:39470576-39470598 TGGCTGCTGCAGAGGCAGGAGGG + Intronic
1183831799 22:40422141-40422163 AGGCAGAGGCAGAGGCAGAGAGG + Intronic
1183910375 22:41074742-41074764 AGCCAGGTCCAGAGGCAGGATGG + Intergenic
1184095470 22:42314081-42314103 AGGCAGATACAGGCTCAGCAGGG + Intronic
1184339651 22:43879278-43879300 AGGCAGGGGCTGGGTCAGGAGGG - Intergenic
1184378984 22:44133208-44133230 AGGCAGAAGCAGAGGCATGAGGG + Intronic
1184386564 22:44179912-44179934 AGGAAGCTGCCGAGTCAGGCTGG + Intronic
1184521052 22:44994376-44994398 AGACAGAGGCAGAGACTGGAGGG + Intronic
1184886033 22:47345001-47345023 AGACAGAGGCAGATTCTGGAGGG + Intergenic
1185077032 22:48689095-48689117 AGGCAGGTGCAGAGGCTGGAGGG - Intronic
1185169754 22:49285930-49285952 AGGCAGATGCGGAGTCTGGCGGG + Intergenic
1185273544 22:49939642-49939664 AGGCAGCTGCACAGACAGAAAGG + Intergenic
949875405 3:8623351-8623373 AGTAAGACGCAGAGGCAGGAAGG - Intronic
950018098 3:9768356-9768378 ACCCAGATGGGGAGTCAGGAGGG - Intronic
950187986 3:10957235-10957257 CAGCAGATGCAGAAGCAGGAGGG + Intergenic
950970933 3:17187167-17187189 AGCAACATGCAGAGTCAGGGAGG - Intronic
951858377 3:27223652-27223674 AGGCAAACACAGAGACAGGAAGG - Intronic
952910681 3:38182193-38182215 AGGCAGCTGCAGAGATAGAACGG - Intronic
953385513 3:42503612-42503634 AGGCAGATGCTGATTGAGGCAGG + Intronic
953563619 3:44013308-44013330 AGACAGAGGCAGAATGAGGATGG - Intergenic
953635035 3:44656222-44656244 AGAGAGATGAAGAGTCAGTAGGG + Intronic
954299449 3:49691666-49691688 AGGAAGAAGCAGAGTACGGAAGG - Intronic
954443267 3:50533363-50533385 AGGCAGGTGCAGAGGCTGGTGGG + Intergenic
954879255 3:53822801-53822823 AGGCAGATGTGGACTCAGTAGGG - Intronic
955229607 3:57086997-57087019 AGGAAGAGGTGGAGTCAGGAGGG + Intergenic
955829154 3:62982985-62983007 AGGAGGAGGCAGAGTAAGGAAGG + Intergenic
956146744 3:66198494-66198516 GGTCAGGTGCAGGGTCAGGATGG - Intronic
956727890 3:72171482-72171504 AGGCTGTTGCAGAGACAGAAAGG - Intergenic
956806804 3:72822356-72822378 GGTCAGATGAAGGGTCAGGAGGG + Intronic
959933928 3:112010857-112010879 AGGCAGATGGAAAGTGAGAATGG - Intronic
959993049 3:112649697-112649719 AGGCAGATCCAGAGTGAAGAGGG - Intergenic
961709696 3:128818606-128818628 AGGCAATTTCAGAGTCAGGTAGG - Intergenic
961804057 3:129476134-129476156 AGGGAGATGCAGAGGCAGAGAGG + Intronic
961829401 3:129615774-129615796 AGGATGCAGCAGAGTCAGGAGGG + Intergenic
962464914 3:135649188-135649210 AGGAAGCTGCAGTGTGAGGAAGG + Intergenic
964203884 3:154148824-154148846 AGGCTGACCCAGGGTCAGGATGG + Intronic
965911619 3:173784553-173784575 AGGCAGAGACAGAGACAGAAAGG + Intronic
966872839 3:184302881-184302903 AGTCAGAGGTAGAGTCAGGGAGG - Intronic
966950758 3:184815042-184815064 AGGCCTACACAGAGTCAGGAAGG + Intronic
967442722 3:189527647-189527669 AGGCAGATGCATAATGAGGTGGG - Intergenic
968395497 4:232899-232921 AGGCAGATGCAGAGAGAGTTGGG + Intergenic
968607208 4:1541175-1541197 AGGCACAGGCAGAGTCAAGGAGG + Intergenic
968623327 4:1614430-1614452 AGGGGGATGCAGAGACATGAGGG + Intergenic
968949976 4:3685465-3685487 AGGCAGCTGGAGAGTGAGGCTGG + Intergenic
969498659 4:7540201-7540223 AGGCAGAGGCAGGGGCAGGGAGG - Intronic
969833337 4:9817103-9817125 TGGCAGAGTCAGAGTCAGAAAGG - Intronic
969956328 4:10895000-10895022 AGGGAGATGGAGAATAAGGAAGG + Intergenic
970223806 4:13836669-13836691 AGGCAGATGGAGGGGCAGGCAGG + Intergenic
970935246 4:21562095-21562117 AGGCAAATGGAGAGACAGAAAGG - Intronic
971218076 4:24680511-24680533 AGGCAGGTGCAGAGAGAGGGAGG + Intergenic
971228904 4:24781597-24781619 ATGCAGATGCAGAGCCATCAGGG + Intergenic
971238487 4:24865718-24865740 TGGCAGATGCAGAATCATAATGG - Intronic
972108946 4:35530778-35530800 AGGCAGATTCAGTGTTGGGAAGG + Intergenic
973315199 4:48752354-48752376 GGGCAGATCCGGAGTCAAGATGG - Intronic
975510323 4:75187711-75187733 AGGCAGATTCAGTGGTAGGAGGG - Intergenic
975793875 4:77984790-77984812 AGGCAGAGGCAGAGGCAGAGGGG + Intergenic
976119352 4:81762674-81762696 AGGCAGCTGCAGAGTCAGCCAGG - Intronic
976687239 4:87827847-87827869 AGCCAGATGCAGAATCATGGAGG - Intronic
976718765 4:88150416-88150438 AGGCTGAAGCAGAGTGAGGGAGG + Intronic
976956425 4:90906391-90906413 AGACACTTGCAGAGTCAGCATGG - Intronic
978648337 4:110969469-110969491 AGCCAGATGCAGGGCCAGGGAGG - Intergenic
978721745 4:111918015-111918037 ATGCAGTGGCAGAGCCAGGAAGG - Intergenic
981625307 4:146748005-146748027 AGGCAGATGCAGAAGCAGCAAGG - Intronic
981761483 4:148200125-148200147 TGGCAGAAGCACAGGCAGGATGG + Intronic
982900916 4:161002527-161002549 ATCCAGGTGCAGAGTGAGGAGGG + Intergenic
984617284 4:181913200-181913222 ACGCAGAAGCCGAGACAGGAAGG + Intergenic
984821436 4:183886046-183886068 AGGCAGATGCAAGATCAGGAGGG + Intronic
984821445 4:183886098-183886120 AGGCAGATGCAAAATCAGGAGGG + Intronic
984821453 4:183886150-183886172 AGGCAGATGCAAGATCAGGAGGG + Intronic
984821461 4:183886202-183886224 AGGCAGATGCAAGATCAGGAAGG + Intronic
984821469 4:183886254-183886276 AGGCAGATGCAAGATCAGGAGGG + Intronic
985028848 4:185768173-185768195 AGGCAGATGAACAGTCTGGTAGG - Intronic
985089428 4:186348361-186348383 AGGCAGATCCAGCCTCTGGATGG - Intergenic
985246718 4:187986457-187986479 AGGAAGACACAGAGACAGGAAGG + Intergenic
985543729 5:498992-499014 AGGGAGATGCAGGGTCACCAAGG - Intronic
985750682 5:1672536-1672558 AGGCAGATGCAGATGCAAGCTGG - Intergenic
985987374 5:3527386-3527408 TGGCAGATGCAAAGAGAGGAGGG + Intergenic
985996623 5:3600575-3600597 CGGAAGAGGCAGAGTTAGGACGG - Intronic
986000478 5:3627209-3627231 AGACATATGCAGAGTAAGAAAGG + Intergenic
986556251 5:9012566-9012588 AGGGAAATGGAGAGTCAGGTTGG - Intergenic
987979766 5:25067777-25067799 AGGCAGATGTACAAACAGGATGG - Intergenic
990476289 5:56164351-56164373 AGGCAGCTCCAGGGACAGGAAGG - Intronic
990969872 5:61493571-61493593 AATCAGTTGGAGAGTCAGGAAGG + Intronic
991799209 5:70341547-70341569 AGGCAGAAGCAGAGTAACAAGGG - Intergenic
992240212 5:74761400-74761422 AGTCAGAAGCTGAGTCAGAAAGG + Intronic
992689858 5:79231663-79231685 GGGCAGAGGCAGAATCAGGCAGG - Intronic
993522031 5:88914918-88914940 AGGCAGAAGCAGAGGAGGGAAGG - Intergenic
995808988 5:116084382-116084404 CTGCAGATGCAGATACAGGAGGG + Intergenic
996472211 5:123873946-123873968 AGTAAGCAGCAGAGTCAGGATGG + Intergenic
997056924 5:130454297-130454319 AGGCAGATTCAGTGTCTTGAGGG - Intergenic
997283514 5:132662976-132662998 AGGCAGGTGCACAGTGCGGATGG + Intergenic
998250655 5:140549906-140549928 AGGCACAGGGAGAGACAGGATGG - Intronic
999068018 5:148712861-148712883 AGGCAGACCCAGAGTTAGCAGGG + Intergenic
999454143 5:151700879-151700901 AGGCAGAGGCAGAGATAGAAAGG + Intergenic
999743049 5:154571467-154571489 ATGCAGATTCTGATTCAGGAAGG + Intergenic
1000210262 5:159101356-159101378 TGGCAGAGACAGAGTTAGGAAGG - Intergenic
1000530257 5:162410547-162410569 AGGCATGTGCAGAGACTGGATGG - Intergenic
1001319943 5:170672284-170672306 TGGCAGCTGCAGAGACAGCATGG + Intronic
1002099519 5:176850516-176850538 AGGCAGAAGGAGAGTCGGGATGG + Intronic
1002160094 5:177309945-177309967 AGGCAGCTCCAGGGACAGGAGGG - Intronic
1002191126 5:177478197-177478219 AGGCAGTGGCAGAATCATGAGGG + Intergenic
1002336949 5:178486235-178486257 AGGCAGCTGCAGAATGAGGACGG + Intronic
1003708784 6:8565616-8565638 AGGCAGGTGGAGATTGAGGAGGG + Intergenic
1006362526 6:33594791-33594813 AGGCAGATGCAGTGAGAGGATGG - Intergenic
1006580327 6:35073360-35073382 TGGAAGAGGCAGAGCCAGGATGG - Intronic
1007183343 6:39946689-39946711 AGACAGATCCAGAGGTAGGATGG - Intergenic
1008385000 6:50879241-50879263 ACTCTGATGGAGAGTCAGGAGGG + Intergenic
1008459530 6:51752113-51752135 AGGAAGATGGGGAATCAGGAAGG - Intronic
1008467018 6:51842508-51842530 AGCCCGATGCAGAGTCAGTGGGG - Intronic
1008583713 6:52929923-52929945 ATGCAGATGCTGATTCAGTAAGG + Intergenic
1009388840 6:63121088-63121110 AAGCACATGGAGAGTCAGGGAGG - Intergenic
1009901448 6:69812240-69812262 AGGTGGAAGCAGAGTCAGGTGGG + Intergenic
1011253826 6:85401416-85401438 TACCAGATGCAGACTCAGGAAGG + Intergenic
1011850726 6:91625102-91625124 AGACAGAAGCAGAGTAAAGAGGG - Intergenic
1013825722 6:114208618-114208640 AGTCAGATTCAGAGTCAACACGG - Intronic
1015466062 6:133549922-133549944 CGGCACATACAGAGTCAGGCTGG + Intergenic
1017479689 6:154839737-154839759 AGGCGGAGGCAGAGGCAGAAGGG - Intronic
1018036699 6:159888207-159888229 AGAAAGATGGAGAGTCAGGAGGG - Intergenic
1018581639 6:165313008-165313030 GGGCAGGGGCAGAGTCCGGAGGG + Intergenic
1019190429 6:170247644-170247666 GGGCAGCAGCAGAGGCAGGAGGG + Intergenic
1019274178 7:167196-167218 GGGCAGCTGCAGCCTCAGGAAGG - Intergenic
1019450102 7:1093148-1093170 AGGCAGGTGCAGCGGCAGGCAGG - Exonic
1019512291 7:1423783-1423805 AGACAGAGGCAGAGACAGAAAGG + Intergenic
1019532086 7:1508705-1508727 AGTCAGAGGCAGAGGCTGGAGGG - Intergenic
1020324012 7:6960650-6960672 AGCCAGATCCAGTGTGAGGAGGG + Intergenic
1021067721 7:16197577-16197599 AGGCAGAGGCAGAGGCAGGAAGG - Intronic
1021067882 7:16198794-16198816 AGGCAGAGGCAGAGGCAGGAAGG - Intronic
1021825591 7:24547560-24547582 AGGCAAATCCTGAGGCAGGAAGG + Intergenic
1022516719 7:30979376-30979398 AGTCAGATGCAGAGACAGGGAGG - Exonic
1025175803 7:56801871-56801893 AGGCAGAGGCAGGGTCTGTACGG + Intergenic
1025695989 7:63774551-63774573 AGGCAGAGGCAGGGTCTGTACGG - Intergenic
1026093802 7:67324396-67324418 AGGCAGAAGCAGAGGAGGGAAGG + Intergenic
1026458952 7:70596406-70596428 AGGCAGAGGCAGAGGCCGGCTGG + Intronic
1027292178 7:76726088-76726110 TAGCAGGTGCAGAGTCAAGAAGG - Intergenic
1027748310 7:82107427-82107449 AGGGAGAAGCAGAGAGAGGAAGG - Intronic
1028090887 7:86699334-86699356 ATCCAGATGCAGAATCTGGATGG + Intronic
1028129447 7:87152703-87152725 CGGCAGCTGCAACGTCAGGAAGG - Exonic
1028634312 7:92970403-92970425 AAGGTGATGAAGAGTCAGGAGGG + Intergenic
1029382507 7:100222876-100222898 AGTGAGATGGAGAATCAGGACGG - Intronic
1029414177 7:100432719-100432741 AGGAAGAAGCAGAGGCAGGAAGG + Intronic
1029690099 7:102175567-102175589 AGGCAGGTGCAGAGGCTGGCAGG - Intronic
1030160360 7:106502159-106502181 CTGCAGAAGCAGAGTCAGGAGGG - Intergenic
1030656525 7:112174055-112174077 ACGCAGGTGGAGACTCAGGAGGG - Intronic
1032566685 7:132954108-132954130 AGGCAGAGGGACAGGCAGGAGGG + Intronic
1033619988 7:143053241-143053263 GGGCAGATGCAGAGGCTGAAAGG + Exonic
1034413263 7:150952252-150952274 AGGCAGCTGCAGAGGCAAGGTGG - Intronic
1034563517 7:151896305-151896327 AGGCAGGTGCACAGTCATGCTGG - Intergenic
1035032214 7:155868870-155868892 TGGCAGAAGGAGAGCCAGGAGGG + Intergenic
1035649046 8:1250625-1250647 AGTCAGATGCACAGACAGGGAGG - Intergenic
1036740881 8:11360747-11360769 AGGCTGATGCTGAACCAGGAAGG - Intergenic
1036747490 8:11420245-11420267 AGGCAGCTGCAGAGGCTGGCGGG - Intronic
1037164557 8:15810933-15810955 AGGCAGATGCTGGGTGAGTAAGG + Intergenic
1037312885 8:17575320-17575342 TGGCACATGCATAGTCAGCATGG + Intergenic
1037818779 8:22125611-22125633 AGGCAGCTGGAGAGGGAGGAGGG - Exonic
1038398993 8:27268836-27268858 ATGCAGATGCAGAATAAGGTGGG - Intergenic
1038579445 8:28734836-28734858 AGGCAGCTCCAGAGCCAGGTAGG - Intronic
1038968858 8:32608498-32608520 AGTCAGATACAGAGTAAGGCTGG - Intronic
1039091599 8:33835539-33835561 AGGCTGAAGGAGAGGCAGGAAGG + Intergenic
1040535226 8:48303291-48303313 AGGCAAATGTAGAGCCAGTAGGG + Intergenic
1040801678 8:51349226-51349248 AGGCAGGAGCAGCGTCAGGGTGG - Intronic
1041256619 8:55984328-55984350 GGGCAGATGCTGAGCCAGCAGGG - Intronic
1042132557 8:65602103-65602125 AGGCAGGTGTGGTGTCAGGAAGG + Intergenic
1042146946 8:65739952-65739974 TGGCAGAGGCAATGTCAGGAGGG - Intronic
1042809521 8:72808802-72808824 ATGCAGATTTAGGGTCAGGAAGG - Intronic
1044722014 8:95160060-95160082 AGGCTCATGCAGGGTGAGGAGGG - Intergenic
1045030064 8:98126624-98126646 ATATAGATTCAGAGTCAGGAAGG + Intronic
1045188987 8:99864963-99864985 AGGGTGAAGCAGAGTCAAGAAGG - Intronic
1046187414 8:110739871-110739893 AGACTGATTCAGAATCAGGATGG - Intergenic
1046287164 8:112109154-112109176 TGGCTAATGCAGAGTGAGGAAGG + Intergenic
1047539847 8:125754184-125754206 AGCCAGAGGAAGAGGCAGGAGGG - Intergenic
1048427127 8:134333099-134333121 ATGCAGATGAAGAGTCAGGAAGG + Intergenic
1048672713 8:136740860-136740882 AGGGAAATTCAGAGTCTGGATGG + Intergenic
1049057979 8:140254177-140254199 CTGCAGGAGCAGAGTCAGGAGGG - Intronic
1049228552 8:141470110-141470132 AGGCAGAGGCAGGGCCGGGAAGG - Intergenic
1049351653 8:142167847-142167869 GGGCAGGTGCAGAGGGAGGAAGG - Intergenic
1049365416 8:142234635-142234657 AGGGAGCTGCAGAGGCTGGAGGG - Intronic
1049389383 8:142360238-142360260 AGGCAGAGGCATGGCCAGGAGGG + Intronic
1049397266 8:142406805-142406827 ACGCAGAGGCAGTGTCATGAGGG + Intergenic
1049603337 8:143518132-143518154 AGGCAGCTCCAGGGCCAGGATGG + Intronic
1050192847 9:3046585-3046607 AGGCAGATGCAGAGGCCAGGTGG - Intergenic
1051096058 9:13466447-13466469 AGGCAGTTGCAGAGTAAAGATGG + Intergenic
1051606434 9:18922096-18922118 AGGCAGAGGCATAGGCAGGCAGG + Intergenic
1052360739 9:27553807-27553829 AGGGATATGCAGAATCTGGAAGG + Intronic
1052964773 9:34331531-34331553 AGACAGATGCAGGGGCAGGTTGG + Intronic
1053297100 9:36922933-36922955 AGGCAGAATCTGAGTCAAGAAGG - Intronic
1053729645 9:41040224-41040246 GGGCAGATGCAGAGCCAGTTAGG + Intergenic
1054698861 9:68391838-68391860 GGGCAGATGCAGAGCCAGTTAGG - Intronic
1056622167 9:88223639-88223661 AGACAGAGACAGAGACAGGAAGG + Intergenic
1056766554 9:89447754-89447776 GGGCTGAGGCAGAGTCAGGAAGG - Intronic
1056844424 9:90025065-90025087 AAGCAGAAGCCGTGTCAGGAGGG + Intergenic
1056947756 9:91014170-91014192 CATCAGATGCAGAGACAGGAAGG + Intergenic
1056965628 9:91161121-91161143 TGGCAGGCGCAGAGGCAGGAAGG - Intergenic
1057743612 9:97733972-97733994 TGGCAGAGGCAGAGGGAGGAGGG + Intergenic
1058957707 9:109964375-109964397 AGGCAGAGGCAGAGGCAGGAAGG + Intronic
1059738574 9:117127349-117127371 AGGCTGATACAGATACAGGAAGG + Intronic
1060278284 9:122198526-122198548 AGGAAGGTGGAGAGGCAGGAAGG + Intronic
1060442676 9:123656183-123656205 AGGCAGAGGCAAAGACAGGGTGG + Intronic
1060817023 9:126640385-126640407 GGGCAGCTGCAGAGCCAAGAAGG + Intronic
1061334620 9:129923963-129923985 AGGGTGAGGCAGAGGCAGGAGGG + Exonic
1061524703 9:131149777-131149799 GGGCAGGGGTAGAGTCAGGAAGG - Intronic
1062004191 9:134231071-134231093 AGGAAGATTCAGGGTGAGGAGGG + Intergenic
1062112436 9:134789411-134789433 AGGAAGGGGCAGAGGCAGGAAGG + Intronic
1062582732 9:137235648-137235670 AGGCACAGGCAGAGCCAGGTCGG + Intronic
1185551154 X:983360-983382 AGCCAGATGCCTAGGCAGGAAGG + Intergenic
1186072904 X:5842106-5842128 AAGCAGAAGCAGAAACAGGAGGG + Intronic
1186326315 X:8481155-8481177 ATGCAGATGCTGATTCAGCAGGG + Intergenic
1187221494 X:17330948-17330970 AGGCAGCTGCTGGGTCAGCAAGG + Intergenic
1187305982 X:18095664-18095686 ATGCAGATTCTGAGTCAGTAGGG + Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1189277336 X:39796527-39796549 AAGCAGTTGCAGAGACAGAAGGG + Intergenic
1190584301 X:51922716-51922738 AGGCAGATGCAGAGAGGGAAAGG - Intergenic
1190739468 X:53279881-53279903 AGGAAGATGGAGAGAGAGGAAGG + Intronic
1192190291 X:68987140-68987162 GGGCAGCAGCAGAGGCAGGATGG - Intergenic
1195752199 X:108170451-108170473 AGGAAGATGAAGAGTAATGAAGG - Intronic
1196943269 X:120798637-120798659 AGGGAGAAGCAATGTCAGGATGG + Intergenic
1197705044 X:129628882-129628904 AGGAGGATGAAGAGTGAGGAGGG + Intergenic
1199170166 X:144726198-144726220 ATGAAGAGGCAAAGTCAGGAGGG - Intergenic
1199675146 X:150182322-150182344 AGCCAGAGGCAGAGTGAGGAAGG + Intergenic
1200022796 X:153226081-153226103 AGGCAGCTTCAGAGACAGGCTGG + Intergenic
1200981958 Y:9270688-9270710 TGGCAGAGGCAGAGTCAGTCTGG + Intergenic
1201144591 Y:11057038-11057060 AGGCAGAGTCAGAGCCAGGCTGG + Intergenic
1202128455 Y:21589042-21589064 TGGCAGAGGCAGAGTCAGTCTGG - Intergenic