ID: 1132058358

View in Genome Browser
Species Human (GRCh38)
Location 15:98669738-98669760
Sequence CGGGGCTGACTGCACAGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 178}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132058358_1132058363 4 Left 1132058358 15:98669738-98669760 CCCAGGCTGTGCAGTCAGCCCCG 0: 1
1: 0
2: 1
3: 24
4: 178
Right 1132058363 15:98669765-98669787 CTAGCTTCCCGTGCCGAACCTGG 0: 1
1: 0
2: 0
3: 1
4: 26
1132058358_1132058370 25 Left 1132058358 15:98669738-98669760 CCCAGGCTGTGCAGTCAGCCCCG 0: 1
1: 0
2: 1
3: 24
4: 178
Right 1132058370 15:98669786-98669808 GGCCCTGGAGGCTGTCTGCCTGG 0: 1
1: 0
2: 3
3: 78
4: 584
1132058358_1132058364 10 Left 1132058358 15:98669738-98669760 CCCAGGCTGTGCAGTCAGCCCCG 0: 1
1: 0
2: 1
3: 24
4: 178
Right 1132058364 15:98669771-98669793 TCCCGTGCCGAACCTGGCCCTGG 0: 1
1: 0
2: 1
3: 13
4: 103
1132058358_1132058367 13 Left 1132058358 15:98669738-98669760 CCCAGGCTGTGCAGTCAGCCCCG 0: 1
1: 0
2: 1
3: 24
4: 178
Right 1132058367 15:98669774-98669796 CGTGCCGAACCTGGCCCTGGAGG 0: 1
1: 0
2: 2
3: 11
4: 106
1132058358_1132058373 30 Left 1132058358 15:98669738-98669760 CCCAGGCTGTGCAGTCAGCCCCG 0: 1
1: 0
2: 1
3: 24
4: 178
Right 1132058373 15:98669791-98669813 TGGAGGCTGTCTGCCTGGCAAGG 0: 1
1: 0
2: 2
3: 38
4: 341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132058358 Original CRISPR CGGGGCTGACTGCACAGCCT GGG (reversed) Intronic