ID: 1132058449

View in Genome Browser
Species Human (GRCh38)
Location 15:98670259-98670281
Sequence CATTTTGCCCAGAGGGATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 210}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132058445_1132058449 -1 Left 1132058445 15:98670237-98670259 CCCTGGAATTGGAGGAAGAGATC 0: 1
1: 1
2: 1
3: 28
4: 228
Right 1132058449 15:98670259-98670281 CATTTTGCCCAGAGGGATCTTGG 0: 1
1: 0
2: 0
3: 19
4: 210
1132058446_1132058449 -2 Left 1132058446 15:98670238-98670260 CCTGGAATTGGAGGAAGAGATCA 0: 1
1: 1
2: 4
3: 71
4: 341
Right 1132058449 15:98670259-98670281 CATTTTGCCCAGAGGGATCTTGG 0: 1
1: 0
2: 0
3: 19
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132058449 Original CRISPR CATTTTGCCCAGAGGGATCT TGG Intronic
902594055 1:17495930-17495952 CATGTTGCCCAGACTGGTCTCGG + Intergenic
903098357 1:21002784-21002806 CATTCTGTCCAGAGGGATAAGGG + Exonic
903450614 1:23451547-23451569 CAATTTGCCCAGAGGGAAGCTGG + Intronic
904087799 1:27922180-27922202 CATGTTGCCCAGGGTGGTCTGGG + Intergenic
904877797 1:33669954-33669976 CAGTATTTCCAGAGGGATCTTGG + Intronic
904927412 1:34059834-34059856 GATTCAGCCCAGAGGGATCTGGG - Intronic
905275478 1:36815207-36815229 GATGTTGCCAAGAGGGATGTTGG - Intronic
905510315 1:38514255-38514277 CATTTTACCAGGAGGGAACTTGG + Intergenic
906240735 1:44240760-44240782 CACTTTGCCCAGTGGGGCCTAGG + Intronic
906650616 1:47509949-47509971 CATTTTACCCAGAGAGATAAAGG + Intergenic
906957513 1:50387492-50387514 CCTTCTACCCAAAGGGATCTGGG - Intergenic
907416199 1:54315861-54315883 CATATTGCCCAGATTGGTCTCGG + Intronic
908359401 1:63353854-63353876 AATTTTCCCCAGAGGCATCAGGG - Intergenic
912455185 1:109792325-109792347 TTTCTTGCCCAGAGGGATCCTGG - Intergenic
913111813 1:115663939-115663961 CATTCTGCTCATAGGGACCTGGG + Exonic
916395584 1:164383327-164383349 CATTTCACCCAGAGTGATCTGGG + Intergenic
916442781 1:164843823-164843845 TATATTGCCCAGAAGGTTCTGGG - Intronic
917834232 1:178928186-178928208 CATGTTGTCCAGACTGATCTTGG + Intergenic
918500456 1:185189188-185189210 CATGTTGCCCAGGCTGATCTTGG + Intronic
919047795 1:192475542-192475564 CATTTTGACCAGCGCCATCTTGG - Intergenic
919513809 1:198496863-198496885 CATGTTGCCCAGGCTGATCTTGG + Intergenic
920093344 1:203469996-203470018 CAATTTGCACAGAGGGATTTAGG + Intergenic
920547414 1:206829859-206829881 TTTTTTGCCCACAGGGATCTTGG - Intronic
923574545 1:235146153-235146175 CATTTTGCCCAGGGAGGTCCTGG + Intronic
924091110 1:240501850-240501872 CTTTTTGCTCGGAGGGTTCTTGG - Intronic
924103547 1:240628362-240628384 CAAATTCCTCAGAGGGATCTTGG + Intergenic
1065037049 10:21650021-21650043 TATGTTGCCCAGAGTGTTCTCGG - Intronic
1065098209 10:22303794-22303816 CATGTTGCCCAGGCTGATCTTGG - Intergenic
1065279045 10:24116122-24116144 CATCTTGCCCCCTGGGATCTTGG + Intronic
1066012369 10:31206756-31206778 TATGTTGCCCAGACTGATCTTGG + Intergenic
1066681108 10:37937596-37937618 CTCATTGCCCAGAGGGATTTGGG - Intergenic
1070168762 10:73916753-73916775 CATCCTGGCCAGAGGGGTCTGGG - Exonic
1071100978 10:82037318-82037340 CATTCTGCCCTGATGGAGCTGGG - Intronic
1074051824 10:109887419-109887441 CAGATTGCCCAGAGGGGTCCTGG - Intronic
1078251906 11:9623292-9623314 CATTTTGCCCAGAGCCAGCAGGG + Intergenic
1078856405 11:15209107-15209129 GATTTTGTCCAGTGGGAACTAGG - Intronic
1079123170 11:17699405-17699427 CATGGTTCCAAGAGGGATCTTGG - Intergenic
1083323936 11:61863839-61863861 CATTCTGCCCAGTGGGATAGCGG - Intronic
1083404513 11:62447329-62447351 CCTTCTGCCCAGTGGGATCTAGG + Intronic
1085757994 11:79217452-79217474 CATTTTTCCCAAATAGATCTAGG + Intronic
1089018765 11:115189376-115189398 TATTGTGCCAAGAGGGATCAGGG + Intronic
1090284765 11:125490411-125490433 CATTTCATCCAGTGGGATCTGGG - Intronic
1090466566 11:126939868-126939890 CAAGTTGCCCAGAGTGACCTTGG - Intronic
1090788168 11:130068730-130068752 CAGTTTACCCACAGGGAACTGGG + Intergenic
1091187837 11:133662422-133662444 CAATTTGCCTGCAGGGATCTAGG + Intergenic
1091675421 12:2485513-2485535 CTTTTTTACCAGAGGGATCTGGG + Intronic
1092272658 12:7035816-7035838 CATTTTGCCCAGGCTGGTCTCGG + Intronic
1094272293 12:28630169-28630191 CCTTGTGCCCAGGGGAATCTGGG - Intergenic
1095053404 12:37574260-37574282 CATGTTGCCCAGGTAGATCTTGG + Intergenic
1095770772 12:45954436-45954458 CATGTTGCCCAGGGTGGTCTTGG + Intronic
1097466649 12:59934204-59934226 CATTTTGCCCAGGGTGTTTTTGG - Intergenic
1097538971 12:60912089-60912111 CATCTTGCCCTGTGGGATTTGGG + Intergenic
1100236054 12:92662097-92662119 CATCTTGCACAGCGGGATCCAGG + Intergenic
1102510541 12:113412397-113412419 CATTCTCCCCAGAGTGACCTAGG - Intronic
1103542259 12:121674194-121674216 TCTTTTGCCCAGAGTGATCTTGG - Intergenic
1104619725 12:130302003-130302025 CATTTTTCCCAGAGGGAAGAGGG - Intergenic
1105204064 13:18205144-18205166 CATTTTGAATAGAAGGATCTTGG - Intergenic
1105305335 13:19164839-19164861 CATGGTGCCCAGATGGCTCTTGG - Intergenic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1107076255 13:36324145-36324167 CATTCTTCCCAGAGGGAAGTGGG + Intronic
1107819067 13:44269950-44269972 CATGTAACCCAGAGGGTTCTTGG - Intergenic
1110175404 13:72549871-72549893 ATTTTTCCCCAGAGGGATCTTGG - Intergenic
1112996346 13:105578861-105578883 CATTCTCCCCAGTAGGATCTGGG + Intergenic
1113158703 13:107354688-107354710 CATTTTGCTCAGAAGAATTTTGG + Intronic
1114291149 14:21289438-21289460 TATGTTGCCCAGACTGATCTTGG - Intronic
1123708018 15:22964614-22964636 CCTTTTTCCCAGAGGGAACATGG - Intronic
1125098608 15:35883769-35883791 CATTTTGCCAACTGGGCTCTGGG + Intergenic
1126267764 15:46774350-46774372 CATTTTTACCTAAGGGATCTAGG - Intergenic
1127498163 15:59531782-59531804 CATTTGCCCAAGAGGGAACTAGG - Intergenic
1127596878 15:60493347-60493369 TATTTTTCCCTGAGGGATCAAGG + Intronic
1127713704 15:61626630-61626652 CACTTTTCCCAGGGGGATCCAGG + Intergenic
1127803678 15:62499245-62499267 CATGTTGCCCAGGCTGATCTTGG - Intronic
1128310625 15:66629935-66629957 CAGTCAGCCCAGAGGGATGTGGG + Intronic
1128609584 15:69063211-69063233 CATTTTACCAAGGGGGAGCTGGG - Intergenic
1128713529 15:69890051-69890073 CATATTGCTCAGTGGGTTCTGGG - Intergenic
1132058449 15:98670259-98670281 CATTTTGCCCAGAGGGATCTTGG + Intronic
1132120722 15:99173054-99173076 CTTTTTGCCTAGAGGGATTCTGG - Intronic
1133103374 16:3492500-3492522 CATCCTGCCCAGAGGGACCTGGG + Intergenic
1137461684 16:48670314-48670336 CTTTGTGCACAGATGGATCTAGG - Intergenic
1138192894 16:55031115-55031137 CATTCTGCCCAGTGAGGTCTGGG - Intergenic
1138676992 16:58658637-58658659 CATGTTGCCCAGGCTGATCTTGG - Intergenic
1139120491 16:64010135-64010157 CATGTTGGCCAGACTGATCTCGG + Intergenic
1140077080 16:71710048-71710070 CATGTTGCCCAGGCTGATCTAGG + Intronic
1140272349 16:73478508-73478530 CAGTTTGCCCAGGGGAATCCTGG - Intergenic
1140693927 16:77513095-77513117 CAGGTTGTCCAGAGGTATCTTGG - Intergenic
1141255905 16:82402098-82402120 CATTTTGCCCTGAGGGAGATGGG + Intergenic
1141726276 16:85791027-85791049 CATGTTGCCCAGGCTGATCTTGG + Intronic
1143670167 17:8391505-8391527 CAAATTGCCCAGAGGGGTATAGG + Exonic
1144170693 17:12657226-12657248 CATGTTGCCCAGGGTGGTCTTGG - Intergenic
1146314709 17:31797851-31797873 CATTTTGGCCAGGCTGATCTCGG + Intergenic
1147770084 17:42861490-42861512 TATGTTGCCCAGAGTGGTCTTGG + Intergenic
1148521161 17:48276334-48276356 AATTTTGCCCAGGGGAATCAGGG - Intronic
1149485038 17:57036084-57036106 CAATTTGTCCAGAGGGCACTTGG - Intergenic
1149497511 17:57128976-57128998 CATGTTGCCCAGACTGGTCTAGG + Intergenic
1151378594 17:73708977-73708999 CATTTTCTCCAGAGGGAAGTTGG - Intergenic
1151638558 17:75371106-75371128 CATGTTGCCCAGACTGGTCTCGG - Intronic
1152611864 17:81318973-81318995 CAGTTTGCCCAGGGCGATCCCGG - Intronic
1152698227 17:81806730-81806752 CATTTTGCCCAGGGAGCTCCTGG + Intronic
1153290009 18:3491899-3491921 CATTTTGCCCAGCAGGTTCAAGG - Intergenic
1155920930 18:31602074-31602096 CAATTTGCCCAAAGCCATCTGGG - Intergenic
1156833065 18:41519123-41519145 TTTTTTGCCCATAGGGATTTGGG + Intergenic
1158863701 18:61617463-61617485 CATGTTGCCCAGTGTGATCTTGG + Intergenic
1162709860 19:12584768-12584790 CATGTTGCCCTGAAGGATCTCGG + Intronic
1163360650 19:16844042-16844064 CATGTTGCCCAGGTGGGTCTTGG + Intronic
1163504002 19:17693740-17693762 CATGTTGCCCAGGCTGATCTGGG + Intergenic
1164939505 19:32241646-32241668 AATTGTGCCGAGAGGGAGCTTGG - Intergenic
1166217780 19:41347222-41347244 CATGTTGCCCAGACTGGTCTCGG + Intronic
1166298550 19:41901652-41901674 CATGTTGCCCAGGCTGATCTTGG + Intronic
1166902618 19:46077400-46077422 CATTTTCACCACAGGGAACTTGG + Intergenic
1168636949 19:58003748-58003770 CATGTTGCCCAGACTGGTCTCGG - Intronic
926266349 2:11325467-11325489 TATTTTAAGCAGAGGGATCTAGG + Intronic
927599452 2:24427884-24427906 CATTTTGCCCACAGTGTTCCAGG + Intergenic
927985194 2:27405272-27405294 CATATTGGCCAGAATGATCTCGG + Intronic
930209182 2:48617117-48617139 GATTTTGCCGAGTGGGATCCAGG + Intronic
930736773 2:54787668-54787690 CATTTTGCTCATGGGGAACTTGG + Intronic
933677705 2:85071875-85071897 CATGTTGCCCAGGCTGATCTTGG + Intergenic
933816132 2:86070073-86070095 CATTTCCCCCAGAGTGAGCTGGG - Exonic
936244385 2:110813929-110813951 CAGTTTGCCCAGAGCTTTCTGGG + Intronic
936903777 2:117513590-117513612 TATTTTGCCCAGAGGATTCTGGG + Intergenic
937162492 2:119777855-119777877 CATATTGCCCAGGCTGATCTTGG + Intronic
938294073 2:130166439-130166461 CATGATGCCCAGATGGCTCTTGG - Intronic
938462573 2:131507447-131507469 CATGATGCCCAGATGGCTCTTGG + Intergenic
939234679 2:139476150-139476172 CATATTGCCCTGTGGGAACTGGG - Intergenic
942181843 2:173387804-173387826 CATTTTACCCAGGAGAATCTGGG + Intergenic
942677158 2:178439413-178439435 CATATTGCCCAGAGTTATGTAGG - Intronic
944911305 2:204313127-204313149 CATTTGGCGCAGTGGGATCCAGG + Intergenic
945926044 2:215805478-215805500 CCTTTTGCCCAGGGTGATCTCGG + Intergenic
947131814 2:226934824-226934846 AATTATGCACAGAGGGATGTGGG - Intronic
948288612 2:236807535-236807557 CATGTTGGCCAGAGTGGTCTCGG - Intergenic
948398033 2:237661874-237661896 CATTTTGTCCAAAGGAATCATGG - Intronic
948951867 2:241258050-241258072 CATGTTGCCCAGGCTGATCTTGG - Intronic
1170586195 20:17735833-17735855 CATTTTCCCCAGAGGGTGGTGGG - Exonic
1175812518 20:61866129-61866151 GATTTTGCCCAGAGGACCCTCGG + Intronic
1176713910 21:10332935-10332957 CATTTTGAATAGAAGGATCTTGG + Intergenic
1178961626 21:37071914-37071936 CAGTGTGCCCTGCGGGATCTGGG - Intronic
1178970173 21:37167541-37167563 TGTTTTGCCCACAGGTATCTTGG + Exonic
1179099895 21:38347297-38347319 CACTTTGGCCACAGGGATGTGGG + Intergenic
1181158912 22:20944916-20944938 CATGTTGCCCAGCATGATCTTGG + Intronic
1181836491 22:25614333-25614355 CATGTTGCCCAGGCTGATCTTGG + Intronic
1183779912 22:39992815-39992837 CAATCTGCCCAGTGGGAACTGGG - Intergenic
1185057383 22:48588046-48588068 CATTATGCACAGATGGAGCTTGG - Intronic
949582573 3:5404588-5404610 AATTATGCCCAGAGGCAACTGGG + Intergenic
951628014 3:24687941-24687963 CATTTTGCCCAGAGAGAATTTGG + Intergenic
952742846 3:36750966-36750988 AATTTTGCCCAGTTGGATGTTGG - Intergenic
954990105 3:54833347-54833369 GATTTTGCCCAGATGGACCATGG + Intronic
955552839 3:60102460-60102482 CATTTAGTCCAGAATGATCTGGG + Intronic
956219206 3:66884207-66884229 CATTTTGCCCAGAGACAACTGGG - Intergenic
956238854 3:67106658-67106680 CATCTTTCCCAGTGGGATCTAGG + Intergenic
956676591 3:71739492-71739514 CATGTTGCCCAGACTGGTCTGGG - Intronic
957499350 3:81033839-81033861 CCTTTTGCCCAGATGGATGATGG - Intergenic
957853852 3:85847339-85847361 CATTTTCACCATAGTGATCTAGG + Intronic
960479695 3:118172601-118172623 CATTCTGCCCAGTGGGTTCATGG - Intergenic
961796002 3:129409246-129409268 CATGTTGCCCAGGCTGATCTCGG - Intronic
962721461 3:138179068-138179090 CATTGTGTCCAGAGTGATGTTGG + Intergenic
964558857 3:157970991-157971013 CGTTTTGCCCAAAGGGAATTCGG + Intergenic
965969724 3:174539946-174539968 CATTTTGCCAAGAGAGAATTAGG + Intronic
966917249 3:184591935-184591957 CATTTTGCACACAGAGACCTGGG - Intronic
968038680 3:195570185-195570207 TATTTTTCCCATAGGGATCAGGG - Intronic
969648750 4:8450167-8450189 CATGTTGCCCAGACTGGTCTTGG + Intronic
970386859 4:15564876-15564898 CATTTTGCCCAGGGTGGTCTCGG + Intronic
970592082 4:17568539-17568561 CATGTTGCCCAGTGTGGTCTTGG - Intergenic
974186417 4:58453383-58453405 CATGTTGCCCAGACAGGTCTTGG + Intergenic
974646849 4:64705447-64705469 CACCATGCCCAGAGGGTTCTAGG - Intergenic
974792095 4:66705285-66705307 CATTTGGCACAGAAGGAGCTGGG - Intergenic
976761698 4:88556161-88556183 CATTTTTCACTGAGGGATATTGG - Intronic
979505270 4:121487840-121487862 CATTTTGCCAATTGGGATTTCGG - Intergenic
982383729 4:154777779-154777801 CATTTTTCTCTGAGAGATCTAGG - Intergenic
983387593 4:167084985-167085007 ACTTTTGTCCAGAGGGATCCAGG + Intronic
983945824 4:173584398-173584420 CCTTTTCCCCCAAGGGATCTGGG + Intergenic
985326656 4:188778135-188778157 CATTTTGCAAAGAGGGAACATGG + Intergenic
990357723 5:54986635-54986657 CTGTTTTCCCAGAGGGACCTAGG - Intronic
990415474 5:55581862-55581884 CATGTTGCCCAGACTGATCCTGG - Intergenic
991396474 5:66209525-66209547 GATTTTGCCCTGAGGGCACTGGG - Intergenic
993013625 5:82511194-82511216 CATTTTGCCCTGAGGGAGACTGG + Intergenic
993069009 5:83134835-83134857 CCTTCTGCCCAGAGGGTTCATGG - Intronic
993399973 5:87437296-87437318 CATGTTGGCCAGACGGGTCTTGG - Intergenic
995379426 5:111515463-111515485 CATGTTGCCCAGACTGGTCTGGG - Intergenic
995417140 5:111924395-111924417 CAGTCTGGCCAGAGAGATCTTGG + Intronic
996910217 5:128648519-128648541 CATGTTGCCCAGAATGGTCTTGG - Intronic
1001395049 5:171412736-171412758 CATGTTGCCCAGACTGGTCTTGG + Intergenic
1005678364 6:28179968-28179990 CATGTTGCCCAGACTGGTCTCGG + Intergenic
1006414528 6:33895618-33895640 CCTTCTGCCCAGAGGGAATTTGG - Intergenic
1006915498 6:37591354-37591376 AATATTACCCAGAGGGTTCTGGG + Intergenic
1007092571 6:39193395-39193417 CCTTTTGCCCAGAGGGCAGTGGG - Intronic
1011406784 6:87023548-87023570 CATTTTGCACATACGAATCTTGG + Intergenic
1012355605 6:98310245-98310267 AATTTTCCCCAGAGGTATATTGG + Intergenic
1012927019 6:105278060-105278082 CATTATGCCCAGTGGTTTCTTGG + Exonic
1014835286 6:126154681-126154703 CATTTTCCTCAGTGGCATCTGGG + Intergenic
1020929721 7:14377684-14377706 CATTGTTCCCACAGGCATCTTGG - Intronic
1021500462 7:21327810-21327832 CATATTGCCCAGGCTGATCTGGG - Intergenic
1022261087 7:28705594-28705616 CATTTTCCCCAGAGGGACTTGGG - Intronic
1026061393 7:67029900-67029922 CATGTTGCCCAGGCCGATCTAGG + Intronic
1026501026 7:70943518-70943540 CATTTTGCCCCAAAGGATCAGGG - Intergenic
1026604908 7:71807338-71807360 CATTTTGGGCAGAGGTGTCTAGG - Intronic
1026716955 7:72797513-72797535 CATGTTGCCCAGGCTGATCTAGG - Intronic
1030416604 7:109251855-109251877 CATATTTCCCAAAGGAATCTAGG + Intergenic
1035682263 8:1496652-1496674 CCTGTGGCCCAGAGGGGTCTGGG - Intergenic
1036144996 8:6246577-6246599 CATGTTGGCCTCAGGGATCTTGG - Intergenic
1036557934 8:9876376-9876398 CATTTTGCCCACGGGGTACTTGG + Intergenic
1037804991 8:22054140-22054162 CATTTTGCTGCCAGGGATCTGGG - Intronic
1039351992 8:36773103-36773125 CATTTTCCCCAGAAAGATCATGG - Intergenic
1039384665 8:37123788-37123810 CATGTTGCCCAGGCTGATCTTGG - Intergenic
1043429532 8:80181546-80181568 CATGTTGCCCAGATTGGTCTCGG - Intronic
1046542521 8:115604651-115604673 CATTTTGTCTAGAGGAATCGAGG + Exonic
1046898632 8:119500059-119500081 TATTTTGCCCAAAAGGATATAGG - Intergenic
1047484524 8:125316987-125317009 CATGTTGCCCAGACTGGTCTTGG + Intronic
1047859573 8:128950139-128950161 CATTTTGCACAGAGAGATTAAGG + Intergenic
1049296138 8:141840483-141840505 GATGGTGCCCAGAAGGATCTGGG - Intergenic
1049364399 8:142229869-142229891 CATCTTGAGCTGAGGGATCTCGG + Intronic
1049609030 8:143544279-143544301 CACCTAGCCCAGATGGATCTAGG + Intergenic
1051398529 9:16654047-16654069 CAGTCTGCACAGAGTGATCTGGG + Intronic
1051574050 9:18595092-18595114 CATCTGTCCCAGATGGATCTGGG + Intronic
1052062792 9:23981755-23981777 CATTTTTTCCAGAGGGATTCTGG + Intergenic
1053464156 9:38292696-38292718 CAATCTGCCTAGAGGGCTCTGGG + Intergenic
1056197636 9:84243931-84243953 CATTTTACAAAGAGGGAACTGGG - Intergenic
1056953277 9:91062782-91062804 CACATTGCCCTGGGGGATCTGGG + Intergenic
1057518774 9:95743888-95743910 GCTTTTGCCCAGAGGGTGCTAGG - Intergenic
1059300483 9:113308595-113308617 CAATTCTCCCAGTGGGATCTGGG + Intergenic
1061451778 9:130670826-130670848 CATTTTGGCAAGAGGGCTCCAGG + Intronic
1186097994 X:6122915-6122937 CATTTTCCCAAAATGGATCTGGG + Intronic
1186339601 X:8630043-8630065 CATTCTGCCCTGAGGGAGCATGG + Intronic
1186543765 X:10427348-10427370 AATTTTGCCCACACTGATCTAGG - Intergenic
1188033495 X:25290986-25291008 CATTTTGCCCACATTGATTTGGG - Intergenic
1189338905 X:40189229-40189251 AAATGTGCCCCGAGGGATCTTGG - Intergenic
1190321330 X:49181164-49181186 CATGTTGCCCAGGGTGGTCTTGG - Intronic
1191715768 X:64192572-64192594 CTTTTGGCCCAGGGGCATCTTGG + Exonic
1191857743 X:65640905-65640927 CATGTTGCCCAGGCTGATCTGGG - Intronic
1195895585 X:109743138-109743160 AATTTTGCCCCAAGGGAACTTGG - Intergenic
1196277812 X:113789077-113789099 CATGGTGCCCAGATTGATCTAGG - Intergenic
1196898257 X:120359232-120359254 CATTTTTCCCCTAGGGGTCTAGG + Intergenic