ID: 1132060160

View in Genome Browser
Species Human (GRCh38)
Location 15:98685807-98685829
Sequence GGAGCCGCAGCCTCCTTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 245}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132060150_1132060160 12 Left 1132060150 15:98685772-98685794 CCACTCCACCGCAGGTAGCCTGA 0: 1
1: 0
2: 0
3: 11
4: 96
Right 1132060160 15:98685807-98685829 GGAGCCGCAGCCTCCTTGGGTGG 0: 1
1: 0
2: 0
3: 18
4: 245
1132060151_1132060160 7 Left 1132060151 15:98685777-98685799 CCACCGCAGGTAGCCTGATTGCC 0: 1
1: 0
2: 0
3: 1
4: 59
Right 1132060160 15:98685807-98685829 GGAGCCGCAGCCTCCTTGGGTGG 0: 1
1: 0
2: 0
3: 18
4: 245
1132060148_1132060160 30 Left 1132060148 15:98685754-98685776 CCAGGCATCAGCGGCTCACCACT 0: 1
1: 0
2: 0
3: 7
4: 124
Right 1132060160 15:98685807-98685829 GGAGCCGCAGCCTCCTTGGGTGG 0: 1
1: 0
2: 0
3: 18
4: 245
1132060154_1132060160 -6 Left 1132060154 15:98685790-98685812 CCTGATTGCCCAGCCTTGGAGCC 0: 1
1: 1
2: 1
3: 20
4: 211
Right 1132060160 15:98685807-98685829 GGAGCCGCAGCCTCCTTGGGTGG 0: 1
1: 0
2: 0
3: 18
4: 245
1132060152_1132060160 4 Left 1132060152 15:98685780-98685802 CCGCAGGTAGCCTGATTGCCCAG 0: 1
1: 0
2: 1
3: 5
4: 146
Right 1132060160 15:98685807-98685829 GGAGCCGCAGCCTCCTTGGGTGG 0: 1
1: 0
2: 0
3: 18
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132060160 Original CRISPR GGAGCCGCAGCCTCCTTGGG TGG Intronic
900110649 1:1004095-1004117 GGGGCCTCAGCCTTGTTGGGGGG + Intergenic
900578035 1:3393995-3394017 GGAGCCGCCGCCGCCGCGGGAGG - Intronic
900637348 1:3672460-3672482 GGGGCCGCAGCCGCCTTCGCTGG - Intronic
900661233 1:3785065-3785087 GGTGCTGCAGCCTCCTTTGCAGG - Exonic
901175979 1:7299537-7299559 GGAGCCGCTGGCTCATTGCGAGG - Intronic
901650171 1:10738540-10738562 GGCCCTGCAGCCTCCTTGTGCGG - Intronic
901820876 1:11828644-11828666 GGAGCCGCAGCAGGCTCGGGGGG - Intronic
901857173 1:12052107-12052129 GGGCCCGCAGCCTTCCTGGGAGG - Intergenic
902702741 1:18183775-18183797 GGAGCAGCAGCTCCCTCGGGTGG + Intronic
904771021 1:32881503-32881525 GGGGCCTCAGCCTCCTTTGGTGG + Intergenic
905272523 1:36796259-36796281 AGATCTGCAGCCTCCTGGGGAGG + Exonic
905764041 1:40585472-40585494 TGAATCGCAGCCTCCTCGGGTGG - Intergenic
906099921 1:43253680-43253702 GAAGGGGCAGCCTCCATGGGTGG + Intronic
906692722 1:47803188-47803210 GGTCCCACAGCCTCCATGGGTGG + Intronic
920269430 1:204752146-204752168 GGAACCCCAGCCTCCTGGGTGGG + Intergenic
920417117 1:205806265-205806287 GTGGCCGCAGCATCCCTGGGCGG - Intronic
920504636 1:206507476-206507498 GGAACCGCAGCCTGCTGGGCGGG - Intergenic
921373246 1:214447288-214447310 GGAATCTCAGCCTTCTTGGGAGG - Intronic
921472608 1:215567369-215567391 GCCGCCGCAGCCTGCCTGGGAGG - Intergenic
921621841 1:217334109-217334131 GGAGCTCCAGCCTCCCTGGTGGG - Intergenic
922196126 1:223362566-223362588 ATAGCCTCAGCCTCCGTGGGCGG - Intronic
923049208 1:230378969-230378991 AGAGCTGCAGCCACCTTGAGGGG + Intronic
923163414 1:231337387-231337409 GGAGCCGCCGCCGCCTCTGGAGG - Exonic
1063411972 10:5843120-5843142 GTAGTCCCAGCCTACTTGGGAGG + Intergenic
1063484862 10:6410431-6410453 GAAGCTGCTGCCTTCTTGGGAGG + Intergenic
1064553000 10:16521264-16521286 CCAGCCGCAGCCTCCGCGGGGGG - Exonic
1067288494 10:44924526-44924548 GCAGGCCCACCCTCCTTGGGGGG - Intronic
1067546878 10:47198262-47198284 GAAGCCGCAGCCTCCTGTGGGGG - Intergenic
1070390662 10:75967809-75967831 GGACCAGCAGCTTCCCTGGGAGG + Intronic
1074281034 10:112051799-112051821 GCAGCCTCAACCTCCTGGGGGGG + Intergenic
1074704739 10:116120797-116120819 AGAGCTGCTGCATCCTTGGGTGG - Intronic
1075734842 10:124658287-124658309 GGACCTGAAACCTCCTTGGGTGG - Intronic
1076670534 10:132118437-132118459 GGAGCCCCGGGCACCTTGGGTGG + Intronic
1077096747 11:802206-802228 GGAGCTGCAGCCCCATGGGGTGG - Exonic
1077278428 11:1729414-1729436 GGAGGCGCAGCCATCTTGGAGGG + Intergenic
1077410347 11:2400934-2400956 GGACCCACAGCATCCTTGTGAGG + Intronic
1077467563 11:2740758-2740780 TGAGCCGCAGCCGCCTTTGAGGG - Intronic
1077532347 11:3103205-3103227 GGAGCCCCACCCTCCCTGGCTGG + Intronic
1078904394 11:15670889-15670911 GGAGCCGCAGGCTCCCGGCGTGG + Intergenic
1081968479 11:47183468-47183490 GGAGCTGGGGCCTCCTTAGGAGG - Intronic
1083775923 11:64894315-64894337 GGAGTGGCAGCCTCCTGGGAGGG + Intergenic
1088436035 11:109814188-109814210 AGAGCAGAAGCCTCCCTGGGAGG - Intergenic
1088716645 11:112554876-112554898 GGAGCCCCAGCCACAGTGGGTGG - Intergenic
1093261983 12:16950188-16950210 GGAGCCGCAGCCACTTTGGCTGG + Intergenic
1096478363 12:51922427-51922449 GGAGCTGGAGCCTTCTTGGATGG - Intronic
1096866293 12:54565625-54565647 GGCACTGCAGCCTCCTTGGTTGG - Intronic
1097177286 12:57150692-57150714 GGAACCGCAGCCCCCATGTGGGG + Intronic
1098064129 12:66594151-66594173 GGAGCTGCATCTTACTTGGGAGG + Intronic
1098123647 12:67268553-67268575 GGAGGCTCAGCTGCCTTGGGAGG + Intergenic
1101882906 12:108638251-108638273 GGAGCCTCAGTTTCCTTGGAGGG - Intergenic
1104686460 12:130788083-130788105 GGAGGCCCTGCCTCCTTGGGTGG - Intergenic
1104889179 12:132132106-132132128 GGAGCCCGACCCTCCGTGGGCGG - Intergenic
1106454999 13:29919327-29919349 GCAGCCGCAGCATCCTTCAGGGG + Intergenic
1111945842 13:94665047-94665069 GGTGCCACTGCCTCCGTGGGTGG - Intergenic
1112114244 13:96335069-96335091 AGATCCTCAGCCTCCATGGGAGG - Intronic
1113375250 13:109759317-109759339 TCAGCCTCAGCCTCCTGGGGTGG - Intronic
1113775646 13:112943522-112943544 GCAGGCGCAGCCTCCCTGGAAGG - Intronic
1113812256 13:113149903-113149925 TGACCCGCAGACTCCCTGGGAGG + Intergenic
1113880467 13:113622700-113622722 AGAGCCGCAGCCTCTGTGGAAGG + Intronic
1113920267 13:113904054-113904076 GGAGCCGCAGCCTGGAAGGGTGG + Intergenic
1114031457 14:18583982-18584004 GGAGCCGCAGCCCCGCTGGAGGG - Intergenic
1115641814 14:35340101-35340123 GGAGCAGCAGCCTCCTTCCAGGG + Intergenic
1117145742 14:52835584-52835606 GGAGAAGCTGTCTCCTTGGGAGG - Intergenic
1118809236 14:69261273-69261295 GGAGCCGCAGCCGCCCTGCAGGG + Intronic
1122486616 14:102086640-102086662 GGAGCCGCAGCCCGCGCGGGAGG - Intronic
1122649041 14:103215456-103215478 GGAACCGCAGGCACCTTGGGGGG - Intergenic
1123036538 14:105474176-105474198 GGTGCTGAAGGCTCCTTGGGTGG - Intronic
1124216653 15:27812989-27813011 GGTGCAGGAGCCTCCTGGGGAGG - Intronic
1125318660 15:38458938-38458960 GGAACCTCAGCCGCCTGGGGAGG - Intronic
1125919583 15:43517659-43517681 GGAGCTGCCGCCTCCATGAGAGG + Exonic
1127175067 15:56345543-56345565 GTAGTCCCAGCCTACTTGGGAGG - Intronic
1128622429 15:69161371-69161393 GGGGCCGGGGCCGCCTTGGGGGG + Intronic
1129589781 15:76905098-76905120 GGAGCCGCGGTCGCCTGGGGAGG - Intronic
1129651758 15:77496087-77496109 GGAGCCTCAGCCTGCTTGCCCGG + Intergenic
1129954024 15:79617190-79617212 GGAGCTGCAGCCACCTTCTGGGG - Intergenic
1130362751 15:83206995-83207017 GGAGCCGAAGCCTCCGTCGCAGG + Intronic
1132060160 15:98685807-98685829 GGAGCCGCAGCCTCCTTGGGTGG + Intronic
1132874575 16:2130636-2130658 AGAGACACAGCTTCCTTGGGGGG - Intronic
1133225991 16:4340639-4340661 GGAGCAGGAGCCCCCGTGGGTGG - Intronic
1133408757 16:5550438-5550460 GCAGCCTCAGCCTTCTTTGGTGG - Intergenic
1136024439 16:27460893-27460915 GGGGCCACAGCCCCCATGGGGGG + Exonic
1136234303 16:28904761-28904783 GGAGGCCCAGCCACCCTGGGAGG + Exonic
1137698561 16:50478954-50478976 GGAGCCCCACCCTCCTGGGCGGG - Intergenic
1138343686 16:56307166-56307188 GGAGCAGCCCCCTCCTGGGGAGG - Intronic
1138519705 16:57563922-57563944 TGAGCCGCAGCTCCCTGGGGCGG - Exonic
1140927665 16:79599448-79599470 GGTGCCGGCGCCTCCTTGGGCGG - Exonic
1141481133 16:84307739-84307761 GGCGCCCCAGCCTCCTTCGGAGG - Intronic
1141790759 16:86232630-86232652 GGAGCAGCCCTCTCCTTGGGTGG + Intergenic
1142365984 16:89649961-89649983 GAAGCAGAAGCCTGCTTGGGGGG - Intronic
1143247777 17:5500715-5500737 GGAGGCGCCTCCTTCTTGGGCGG + Intronic
1143614582 17:8042282-8042304 GGAGTGGCAGTCCCCTTGGGGGG - Intronic
1144265216 17:13562211-13562233 GGAGCCGCAGCCTGCAAGAGTGG + Intronic
1144646063 17:16974351-16974373 GGAGCAGCTGGCTCCCTGGGGGG + Intergenic
1144789109 17:17847699-17847721 GGGGCAGGAGCCTCCATGGGGGG + Exonic
1146339596 17:32007628-32007650 GGAGCCGCGGGCTGCTTGGTCGG - Intergenic
1146650361 17:34602624-34602646 GGAGCTGCAGCCTCCTGCAGGGG - Intronic
1146831001 17:36069681-36069703 GTAGCCGCTGCCTCCTTCTGGGG - Intronic
1147786250 17:42980663-42980685 GGAGCCGCTGCCACCGTGCGAGG + Exonic
1147922035 17:43923669-43923691 TGAGCTGCAACCTCCTTAGGTGG + Intergenic
1147971127 17:44219544-44219566 GGAGCCGCTGCCGCCGCGGGAGG - Intronic
1148122721 17:45222176-45222198 GGAGGCGCGGGCTGCTTGGGGGG - Exonic
1148178091 17:45584925-45584947 GGAGCCGCGGGCTGCTTGGTCGG + Intergenic
1148866494 17:50631441-50631463 GGAGCTGCAGCCTGGTTTGGGGG + Intergenic
1149997384 17:61412186-61412208 GGAGCCCCCGCCCTCTTGGGAGG + Exonic
1150270212 17:63859326-63859348 GGAGCTGCAGCCTGCCTGGGTGG + Intergenic
1150407987 17:64919215-64919237 GGAGCCGCGGGCTGCTTGGTCGG + Intronic
1150444852 17:65221019-65221041 AGAGCCCCAGGCTCCATGGGAGG + Intronic
1150747232 17:67825746-67825768 GGAGCCGCGGGCTGCTTGGGCGG - Exonic
1150784292 17:68150479-68150501 TGAGCTGCAACCTCCTTAGGTGG + Intergenic
1150983362 17:70168993-70169015 GGCGCTGCAGCCTCCGCGGGGGG + Intronic
1152876033 17:82786652-82786674 GGAGAGGCAGCCTCCTGGTGAGG + Intronic
1157975263 18:52319761-52319783 GGGGCCTCAGCCTCCTTGTGGGG - Intergenic
1159940030 18:74400014-74400036 GGATGTGCAGCCTCCTTGTGGGG - Intergenic
1160592158 18:79951054-79951076 GCCGCCCCAGCCTCCCTGGGCGG - Intronic
1160697085 19:489877-489899 AGAGCCGCAGCCTCCTGGCTGGG - Intronic
1160831837 19:1107974-1107996 GGAGCCCCTTCCTACTTGGGAGG + Exonic
1160956015 19:1692025-1692047 GGAGCCGGAGCCTCTGTGTGTGG + Intergenic
1160972783 19:1776778-1776800 GGGGCCGCCTCCTCCCTGGGAGG - Exonic
1161221794 19:3121226-3121248 GCAGCCGCAGGCTCCGTGGAAGG - Exonic
1161458168 19:4380371-4380393 GGGGCCGCTTCCTCCTTGCGGGG + Intronic
1161701989 19:5800680-5800702 GGAGCAGTGGCCTCCTGGGGAGG + Intergenic
1162273166 19:9632795-9632817 AGAGGCGCAGCTTCCTGGGGAGG - Intronic
1162584324 19:11549820-11549842 GCAGCAGCAGCCTCCCTTGGGGG - Exonic
1162786116 19:13036092-13036114 CCAGCCGCAGCCCCCTTGGTGGG - Intronic
1163028762 19:14529669-14529691 GGAGCAGTAGCCGCCGTGGGAGG + Exonic
1163127739 19:15253407-15253429 TGAGCAGCAGCCTCAGTGGGAGG - Intronic
1164643900 19:29844632-29844654 CGAGCCACGGCCTCCCTGGGCGG + Intergenic
1165386109 19:35511579-35511601 TGAGCCGCTGCCTCCCTGAGGGG + Exonic
1167313894 19:48752903-48752925 GCAGCCGCAGCATCATTGCGTGG + Exonic
1167466385 19:49652778-49652800 GAAGGCGCCGACTCCTTGGGGGG - Exonic
1168153200 19:54460046-54460068 GCAGGGTCAGCCTCCTTGGGGGG - Intronic
925118672 2:1401087-1401109 GGAGCCTCAGTCTCCTGGAGGGG - Intronic
925187084 2:1855471-1855493 AGAGCCGCAGCCTCCCTGAAAGG - Intronic
925287475 2:2725352-2725374 GTAGCAGCAGCTTCCTTGAGTGG - Intergenic
927502245 2:23590628-23590650 GGATCCGCAGCCTCTGTGTGTGG - Intronic
928290955 2:30037078-30037100 GGAGCTGCTGCCATCTTGGGAGG - Intergenic
929534193 2:42770335-42770357 GGAGCAGCAGCCCCGCTGGGAGG - Intronic
931219145 2:60273501-60273523 GGAGAGGCAGCCGCCTTGGCTGG - Intergenic
931872647 2:66477567-66477589 GGAGCCGGAGCCTTCTTTGAGGG - Intronic
932277886 2:70465056-70465078 TGAGCATCATCCTCCTTGGGGGG - Intronic
932433790 2:71691180-71691202 GGAGGCGCAGACTCCAGGGGTGG - Intergenic
933764146 2:85695637-85695659 GCAGCCCCAGGCTCCTTGGAGGG - Intronic
934892756 2:98085144-98085166 AGGGCCGCAGCATCCATGGGAGG + Intergenic
936018688 2:108978535-108978557 TGAACCTCAGCCTCCTTGGGAGG - Intronic
936346646 2:111680450-111680472 GGAGCAGGAGCCTCCTCTGGTGG + Intergenic
937841252 2:126526751-126526773 TGAGCAGCAGCCTCCTGAGGTGG + Intergenic
938496746 2:131801813-131801835 GGAGCCGCAGCCCCGCTGGAGGG + Intergenic
938811287 2:134855317-134855339 GGGGCAGCAGCCTCCTTGCCAGG - Intronic
938972989 2:136449179-136449201 AGAGCCGCAGCCAGCCTGGGGGG - Intergenic
942271787 2:174282686-174282708 TGAGCCACAGCCTGCTTGGAGGG - Intergenic
946178896 2:217938238-217938260 GCAACCCCAGCCTCCCTGGGTGG + Intronic
946224649 2:218257730-218257752 GCTGCCTCAGCCTCCTTGAGGGG + Intergenic
948258454 2:236585160-236585182 GGAGCTGCTGCCTCCTGGAGAGG - Intergenic
949011156 2:241679329-241679351 AGAGCCGCAGGCTCTGTGGGAGG - Intronic
1169799209 20:9497896-9497918 GGTGCTGCAGCTTCCTTGTGAGG - Intergenic
1170532172 20:17304951-17304973 GGAGCTGCAGCCTGCTGAGGTGG - Intronic
1172600568 20:36179911-36179933 GGAGCCCCAGCCTGGCTGGGAGG + Intronic
1174742785 20:53032147-53032169 GGAAACACAGCCTCCTTAGGAGG + Intronic
1176143899 20:63557058-63557080 GGTGCTGCTGCCTCCTCGGGCGG - Intergenic
1178728098 21:35073098-35073120 AGAGCTGCAGCCTCCGTGGATGG - Intronic
1179886817 21:44317749-44317771 GGAGCCTCATCCTGCATGGGGGG + Intronic
1180181646 21:46120913-46120935 GGAGCCACAGCCTCCGGGGAGGG + Intronic
1180455570 22:15511039-15511061 GGAGCCGCAGCCCCGCTGGAGGG - Intergenic
1181283343 22:21735543-21735565 GCAGCCACAGTATCCTTGGGTGG + Intronic
1181311484 22:21947127-21947149 GGAGCCAGAGCCACCCTGGGAGG - Intronic
1181672619 22:24432787-24432809 GAAGGGGCTGCCTCCTTGGGAGG + Intronic
1182064935 22:27424141-27424163 GGAGCCAAAGCCTCCTTGCTTGG - Intergenic
1182149831 22:28020151-28020173 GGAGCCGCAGCCCCCAGGAGGGG - Intronic
1182586796 22:31348010-31348032 TGAGCCACAGCTTTCTTGGGCGG + Intergenic
1183292365 22:37010571-37010593 GTAGCCCCAGCCTCCTGGGTAGG - Intergenic
1183862415 22:40679583-40679605 GCTGCCGCAGCCTGCGTGGGTGG + Exonic
1184665601 22:45987340-45987362 GGAGCCCCACCCTCCTAGGTGGG + Intergenic
1185119666 22:48958481-48958503 GGAGCCACATTCTCCTTGGAAGG - Intergenic
950074920 3:10180566-10180588 GGAGCCCCAGACACCTGGGGAGG + Intronic
952578174 3:34799864-34799886 GGAGTCCCAGACTCCTTGGATGG - Intergenic
954704702 3:52473238-52473260 AGAGCCTCAGCCTGCTTGGCAGG - Intronic
957678607 3:83403748-83403770 GGAGCCCCACCCTCCTGGGTGGG + Intergenic
960998250 3:123353492-123353514 GGAGCCGGAGCATCATTGTGTGG - Intronic
961554435 3:127688520-127688542 GCAGCAGCAGCCTCCTTGGCAGG - Intergenic
962262831 3:133925956-133925978 GGAACCGCAGCCACCCTGAGAGG + Intergenic
963081794 3:141402113-141402135 GAGGCCGCTGCCTCCTTGGTGGG + Intronic
965793220 3:172411435-172411457 GGAGCCCCACCCTCCTGGGCAGG - Intergenic
968521349 4:1036075-1036097 GGTGCCAGAGCCTCCTGGGGTGG - Intergenic
968650677 4:1759137-1759159 GGAGCGGCAGGCTCCTGGAGTGG + Intergenic
972444921 4:39134958-39134980 GCAGACGCATCCTCCTTAGGTGG - Intergenic
972687145 4:41361848-41361870 GGAGCCTCAGCTTCAATGGGTGG + Intronic
973977432 4:56276690-56276712 GAGGCTGCAGCCTCCTTGAGAGG - Intronic
976629157 4:87219928-87219950 GGAGCCGCGGCCTGCGGGGGCGG - Intronic
978791366 4:112666447-112666469 GCTGCCTCAGCCTCCTGGGGAGG - Intergenic
979346537 4:119593872-119593894 GGAGAAGCAGACACCTTGGGCGG + Intronic
982238561 4:153275601-153275623 GCAGCGTCAGCCTCCCTGGGGGG - Intronic
983222727 4:165058287-165058309 GTAGTCCCAGCCTACTTGGGAGG - Intergenic
985580660 5:693745-693767 GCGGCCGCGGCCTCCTGGGGTGG + Intergenic
985595284 5:785077-785099 GCGGCCGCGGCCTCCTGGGGTGG + Intergenic
985784536 5:1886985-1887007 GGAGCCTCCGCCTCCTCGGAAGG + Exonic
985950369 5:3218091-3218113 GGAGCCGCCCCCTCCCTGGATGG - Intergenic
989048252 5:37294700-37294722 GTAGCCCCAGCTTACTTGGGAGG - Intronic
994725826 5:103434295-103434317 GGAGCCCCACCCTCCTGGGCGGG + Intergenic
997485258 5:134225870-134225892 GGAGCGGCAGCCGGCTGGGGCGG - Exonic
997963202 5:138338139-138338161 GGAGCTGCGCCCTCCATGGGTGG + Exonic
998171872 5:139877359-139877381 GGAGCAGCAGGCTGCTCGGGTGG - Intronic
998193048 5:140043100-140043122 TCAGCCGCCGCCGCCTTGGGAGG + Exonic
999314531 5:150575364-150575386 GGAGCTGCCGCCACCTTGGCTGG - Intergenic
1003275563 6:4647715-4647737 GGAACCGAAGCCGCCTGGGGAGG + Intergenic
1003778782 6:9399038-9399060 GGAGCCCCAGCGTCCTCGGAGGG - Intergenic
1003923433 6:10855425-10855447 GGAGCCCCACCCTCCTGGGCGGG + Intronic
1005332301 6:24761652-24761674 GGAGCCCCACCCTCCTGGGCGGG - Intergenic
1005851784 6:29828180-29828202 GGAGCCGCGGGCGCCGTGGGTGG + Exonic
1006043221 6:31271713-31271735 GGAGCCGCGGGCGCCGTGGGTGG - Exonic
1006361463 6:33589541-33589563 TGTGCTGCAGCCTCCTAGGGAGG + Intergenic
1006470090 6:34223831-34223853 GGGGCCACAGCCTTCTTGAGAGG - Intergenic
1006641065 6:35490170-35490192 GGGGCCACAGCCTGCTTGAGGGG - Intronic
1007057443 6:38901967-38901989 GTAGCAGCTGCCTCCTTGGATGG + Intronic
1008648998 6:53544726-53544748 GGAGCGGCAGCCGCCTTCTGCGG - Exonic
1011497797 6:87953391-87953413 GGAGCCGCAGCATCATTTGAAGG - Intergenic
1012409428 6:98938994-98939016 GTAGCCCCAGCCTCCTGAGGTGG - Intronic
1012427713 6:99132179-99132201 GGAGCCCCAGCCTCCTCTGGGGG - Intergenic
1018628853 6:165805243-165805265 GGAGCCGCTGCCTCCAGGGTAGG - Intronic
1018719740 6:166563464-166563486 GGAGCCGCAGCCCCTGGGGGTGG - Intronic
1019217278 6:170452107-170452129 GGGCCGGCAGCCTTCTTGGGGGG - Intergenic
1019339473 7:502098-502120 GTAGTCCCAGCCTACTTGGGAGG + Intronic
1019474017 7:1235545-1235567 GGAGCCGCCCCTTACTTGGGGGG - Intronic
1019504503 7:1384013-1384035 GGACCCCCAGCTTCCGTGGGTGG + Intergenic
1019913763 7:4117585-4117607 GGTGCCGCAGCTGCCCTGGGTGG + Intronic
1019997526 7:4734396-4734418 GGGCCCGCTCCCTCCTTGGGAGG + Intronic
1020071021 7:5227131-5227153 GAAGCTGCACCCTCCCTGGGGGG - Intronic
1020800752 7:12729279-12729301 AGAGCTGCAGCCTGCTTGCGAGG - Intergenic
1022099158 7:27158794-27158816 GTATCCGCATCCTCCTTGGCCGG - Intergenic
1028561265 7:92179013-92179035 GGAGCCGCAGCCGCCGCGGGAGG - Exonic
1029634687 7:101776144-101776166 GGAGCCCCAGTCTCCTTCAGGGG - Intergenic
1029658795 7:101945225-101945247 AGAGCCGGAGCCTGCCTGGGTGG - Intronic
1033472928 7:141665370-141665392 TGAGCCGCAGGCTCCGAGGGAGG - Intronic
1034259023 7:149742604-149742626 GGAAGGGCAGCCTCCTTCGGAGG + Intergenic
1035025433 7:155822003-155822025 GGACCCGCAGCATCCCTGTGTGG + Intergenic
1035271330 7:157721794-157721816 GGAGCCCCAGGCCCCTGGGGTGG - Intronic
1035930820 8:3777911-3777933 AGACCCGCAGCCTCCTTGAAGGG + Intronic
1036215680 8:6877896-6877918 GGAGACGCTGGCTCCTTTGGAGG + Exonic
1037752032 8:21688910-21688932 CCAGCCTCAGCATCCTTGGGAGG + Intergenic
1038780260 8:30563977-30563999 GCAGCTGCAGCGTCCTGGGGAGG + Intronic
1039006011 8:33037815-33037837 GGAGCCACTGCCTCCTGAGGTGG - Intergenic
1039292522 8:36111788-36111810 GGAGCCCCAGCATCCTTGAGGGG - Intergenic
1042962940 8:74321691-74321713 GGAGCCGCCGCTTCCTCGGCAGG + Intronic
1047836255 8:128696576-128696598 TGAGCCACAGCCTCCTGGGAGGG - Intergenic
1049726302 8:144148050-144148072 GGAGCCGCCGCCACCTCGGCCGG - Intronic
1049728992 8:144166371-144166393 GGAGCGGGAGGCTCCCTGGGTGG + Intronic
1053070141 9:35096337-35096359 CGGGCCCCAGCCTCCTTGCGTGG - Exonic
1061279104 9:129586884-129586906 GGAGCCACAGCCTGGGTGGGTGG - Intergenic
1062046929 9:134428630-134428652 AGAGCCGCAGCCTCTTTCGGGGG - Intronic
1062120426 9:134831145-134831167 CCAGCCCCAGCCTCCCTGGGTGG + Intronic
1062244039 9:135554298-135554320 GGAGACGGAGCTTCCTTTGGGGG - Intergenic
1062249052 9:135584996-135585018 GAAGCCTCAGCATCCTGGGGAGG + Intergenic
1062316053 9:135967429-135967451 GGAGCCCCAGCTGCCCTGGGTGG + Intergenic
1062609235 9:137366542-137366564 GGACCAGCAGCCTCCTCTGGAGG + Exonic
1187648460 X:21374788-21374810 CTGGCCGCAGCCTCCCTGGGCGG - Intronic
1197796145 X:130300082-130300104 GGAGCCCCACCCTCCTGGGTAGG - Intergenic
1198699592 X:139382634-139382656 GGAGCCCCACCCTCCTGGGTGGG - Intergenic
1199360148 X:146907696-146907718 GGAGCCCCACCCTCCTTGGCAGG - Intergenic
1200150120 X:153947205-153947227 CCAGCGGCAGCCTCCTTGGGTGG - Intergenic
1200163611 X:154021221-154021243 GGAGCCACAGCCTGCGGGGGTGG + Intergenic
1200169781 X:154064218-154064240 GGAGGAGCAGACTCCTTGTGTGG - Intronic
1200179879 X:154143779-154143801 GGAACCGGATCCTCCTTGCGAGG - Intergenic
1200551018 Y:4578332-4578354 GGAGCCCCACCCTCCTGGGCGGG - Intergenic
1202337863 Y:23829530-23829552 AGAGTAGCAGCCTCCTTGAGTGG + Intergenic
1202532903 Y:25840541-25840563 AGAGTAGCAGCCTCCTTGAGTGG - Intergenic