ID: 1132061129

View in Genome Browser
Species Human (GRCh38)
Location 15:98693217-98693239
Sequence CTGGATGAGCAGAATGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 321}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132061124_1132061129 2 Left 1132061124 15:98693192-98693214 CCTGTTTGGTCTTGGAAGCTGGG 0: 1
1: 0
2: 0
3: 11
4: 180
Right 1132061129 15:98693217-98693239 CTGGATGAGCAGAATGAGGCAGG 0: 1
1: 0
2: 1
3: 35
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132061129 Original CRISPR CTGGATGAGCAGAATGAGGC AGG Intronic
902074802 1:13775807-13775829 CTGGCAGAGCAGAATGAGAATGG - Intronic
902540857 1:17153500-17153522 CTGTATGGGAAGAATGATGCTGG - Intergenic
902824727 1:18965178-18965200 CATGATGATAAGAATGAGGCAGG - Intergenic
903863052 1:26376906-26376928 CTGGATCAGCAGAGTGACTCTGG + Intergenic
903944196 1:26951497-26951519 CTGGATGAGCAGGATGCTGAGGG - Exonic
904292596 1:29497604-29497626 CTGGATGGGCTGATTGGGGCTGG - Intergenic
905284930 1:36873123-36873145 CAGGATGAGGGGAATGAGGTGGG - Intronic
907272595 1:53299581-53299603 CTGGATGACCAATGTGAGGCTGG - Intronic
908107688 1:60862069-60862091 CATGATGACCTGAATGAGGCTGG + Intergenic
908565719 1:65354193-65354215 ATGGAGGAACAGAATGAGGTGGG + Intronic
913473779 1:119217184-119217206 CTGGACAAGCAGAATGATGATGG - Intergenic
915137050 1:153739904-153739926 CAGGAGGAGGAGACTGAGGCAGG - Intronic
915304607 1:154970316-154970338 CCGGATGAGCAACCTGAGGCTGG - Exonic
915544162 1:156586455-156586477 CTGGATGACCTGAAAGAGGCAGG - Exonic
915959254 1:160251056-160251078 CTTGAGTAGCAGAATGAGGCAGG - Intronic
916943701 1:169702602-169702624 GTGGATGAGCAGAGAGAGGCAGG - Intronic
919259061 1:195166167-195166189 ATGCATAAGCAGAATTAGGCAGG - Intergenic
919775330 1:201190726-201190748 CTGGAGGAGAAGGAGGAGGCGGG + Intergenic
920659973 1:207907420-207907442 CTGGATGAGCAAAGGTAGGCAGG - Intronic
920754471 1:208715997-208716019 CTGGATCAGCAGAATGATTTTGG + Intergenic
922762959 1:228143734-228143756 CTGGGTGAGCAGCAGGAGCCAGG + Intronic
924907630 1:248473493-248473515 GTGGATGAGGAGGATGAGGAGGG - Exonic
924916479 1:248574593-248574615 GTGGATGAGGAGGATGAGGAGGG + Exonic
924948832 1:248864269-248864291 CTGAATGAGCAGTGTGAGGAGGG - Intergenic
1063244799 10:4206739-4206761 CGGGATGAGCAGAAGGAGGATGG - Intergenic
1067079871 10:43206798-43206820 GTGGCTGACCAGTATGAGGCAGG + Intronic
1067749839 10:48963687-48963709 CTTGATGAGCACAAAGAGGCAGG - Intronic
1069486596 10:68827678-68827700 CTGGAGGCGCAGAAGGCGGCGGG + Exonic
1069486683 10:68828014-68828036 CTGGAGGCGCAGAAGGCGGCGGG + Intronic
1069961249 10:72080695-72080717 CTGGATAAACAGAAGGAGACAGG + Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1072307674 10:94122894-94122916 CTGGGTGAGGAGGATGATGCTGG + Intronic
1072343101 10:94475024-94475046 CTGGAAGGGGAGACTGAGGCAGG - Intronic
1072433115 10:95390983-95391005 CTGGCTTAGCAGACTGAGGCAGG + Intronic
1072998781 10:100269968-100269990 ATGGATTAGAAGAATTAGGCGGG + Intergenic
1074734058 10:116409635-116409657 CTGGAACAGAAGAAAGAGGCAGG - Intergenic
1075747236 10:124736435-124736457 CTGGGTGAGGAGAAGGAGCCTGG - Intronic
1076080100 10:127572059-127572081 AAGGATAAGGAGAATGAGGCAGG + Intergenic
1076443834 10:130498388-130498410 ATGGATGAGGAAACTGAGGCAGG - Intergenic
1076519654 10:131073648-131073670 CTGGATGGGCAGGATGTGGATGG + Intergenic
1076934383 10:133557797-133557819 CTGGTAGAGCAGAAAGAGGCAGG - Intronic
1077210625 11:1369550-1369572 ATGGAGGACCAGAAGGAGGCAGG + Intergenic
1077581942 11:3422654-3422676 CAGGATGAGCGTTATGAGGCGGG + Intergenic
1078135369 11:8647731-8647753 CAGGATGATCAGAGTGAGTCTGG - Intronic
1078413780 11:11148860-11148882 GGGGAGAAGCAGAATGAGGCAGG - Intergenic
1078537341 11:12185592-12185614 ATGGATGAGCAGACTGTGGCTGG + Intronic
1080415388 11:32065432-32065454 TTGGATGAGGAGAATGAAGAAGG - Intronic
1080796159 11:35565558-35565580 CCAGCTGGGCAGAATGAGGCAGG + Intergenic
1081802812 11:45871387-45871409 CAGCATGAGCAGCATGTGGCAGG + Intronic
1082817888 11:57522450-57522472 CTGGATGTGGAGAGTGAGGTGGG - Intergenic
1084238857 11:67805471-67805493 CAGGATGAGCGTTATGAGGCGGG + Intergenic
1084508675 11:69587692-69587714 TTGGGTCTGCAGAATGAGGCAGG - Intergenic
1084690477 11:70722416-70722438 CTGGAGGAGCAGAAAGGGACAGG - Intronic
1085501729 11:77030637-77030659 CTGGATGAGAAGAATGAAGGGGG - Intergenic
1085907135 11:80776856-80776878 ATAAATGAGGAGAATGAGGCAGG + Intergenic
1088130600 11:106484634-106484656 CATGATGAGGAGAATGAGGATGG - Intergenic
1088728258 11:112658378-112658400 CTGCATGAGCAGAATGTTGTGGG - Intergenic
1089191232 11:116654768-116654790 CAGCATAAGCAGTATGAGGCTGG - Intergenic
1090225562 11:125070113-125070135 CTGGATGAGCAGGAATGGGCAGG + Intronic
1091334202 11:134754344-134754366 CTGAATGAGCAGAAGGAGCAAGG - Intergenic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1091605632 12:1949164-1949186 CTGTATGGGCAGGAGGAGGCTGG + Exonic
1091733712 12:2901222-2901244 CTACTTGAGGAGAATGAGGCAGG - Intronic
1091889776 12:4044374-4044396 CTGAATGATCAGGAGGAGGCTGG - Intergenic
1091947596 12:4562238-4562260 CGGGAGGAGCTGCATGAGGCCGG - Intronic
1092651688 12:10641784-10641806 CTGGCTGTACAGAATGAGGCAGG - Intronic
1092763898 12:11835462-11835484 CTGCATGGGCAGAATGAGGGAGG - Intronic
1093080393 12:14803634-14803656 CTAGATGAGCGCAATGAGGCGGG - Exonic
1093194559 12:16114660-16114682 TTGCATCAGAAGAATGAGGCAGG - Intergenic
1094030589 12:26007479-26007501 CTGCAAGAGCAGAATGAAGAAGG + Intronic
1094056867 12:26277261-26277283 CTAGCTCAGGAGAATGAGGCAGG - Intronic
1095468138 12:42509472-42509494 AAGGGTGAGCAGAATAAGGCAGG - Intronic
1096194035 12:49637476-49637498 CTGGACGAGCTGCATGAGACAGG + Exonic
1097362205 12:58670566-58670588 CTGGATGAGGAGGCAGAGGCAGG + Intronic
1097707909 12:62887098-62887120 CTGGATGTGGAGAAAGAGGGAGG + Intronic
1098353005 12:69583398-69583420 TTGGATGGGGAGAAGGAGGCAGG - Intergenic
1099263940 12:80419851-80419873 CTGCATGAGAGGAATGAGACTGG - Intronic
1100861464 12:98811322-98811344 ATGGATGTGCAGAAGGAGTCTGG - Intronic
1101387875 12:104273716-104273738 CTGGATGTGCAGGATGGCGCTGG - Intronic
1101527461 12:105544689-105544711 CTGGGTGTGCAGGGTGAGGCTGG - Intergenic
1102198025 12:111038020-111038042 CAGGATGAGCAAAGAGAGGCCGG + Intronic
1102203800 12:111076425-111076447 ATGGATGAGGAAACTGAGGCTGG + Intronic
1102351446 12:112195157-112195179 CTGGAAGAGAAGCCTGAGGCAGG - Intronic
1103702285 12:122854106-122854128 CTGGATGACCTGGATGAGGGGGG - Exonic
1104630993 12:130401997-130402019 CTGGCTGAGTAGAATGTGGGTGG + Intronic
1104723993 12:131064968-131064990 CAGGATGAGCAGCACTAGGCAGG + Intronic
1104768763 12:131346833-131346855 CTGGAGGTGCAGAACGAGGCTGG + Intergenic
1104841695 12:131828792-131828814 CTGGGTGGGGAGACTGAGGCAGG + Intronic
1106145799 13:27048917-27048939 TTGGAGGTGGAGAATGAGGCGGG - Intergenic
1106356621 13:28989648-28989670 CTGGATGGGGAGGATGAGGGTGG + Intronic
1106485250 13:30166731-30166753 CTGGATGAGCAGGAGTAGGCGGG - Intergenic
1109631171 13:65048700-65048722 CAGTATGAGCAGTATGTGGCTGG + Intergenic
1113220242 13:108092544-108092566 CTGTATGAGCAGAAGGGGGATGG - Intergenic
1113424468 13:110196537-110196559 CTGGTTGAGCTGAAGCAGGCAGG - Intronic
1118163980 14:63317840-63317862 CCGGAAGAGCAGCATGAAGCTGG - Exonic
1118764427 14:68900372-68900394 CTGGTTGAGAAGCATCAGGCAGG + Intronic
1118825015 14:69372094-69372116 ATGGATGAGCAGGATGAGTAGGG + Intergenic
1119755885 14:77119261-77119283 CTGGCTGAGGAGGCTGAGGCAGG - Intronic
1119938551 14:78616087-78616109 CTGGAGGAGCTGAGTGAGTCAGG - Intronic
1120137195 14:80884503-80884525 GTGGATGAGCAGAAGTAGGGTGG + Intronic
1120787464 14:88550528-88550550 CTGGGTGAGCAGCTGGAGGCCGG - Exonic
1121891719 14:97600093-97600115 CTGAATGAGAAGAATAAGGTTGG + Intergenic
1121966023 14:98306505-98306527 CTTGATGAAGAGAATGTGGCAGG - Intergenic
1122299232 14:100722663-100722685 GTGGCTGAGCACACTGAGGCTGG - Intergenic
1123580562 15:21711627-21711649 CCTGATGGGAAGAATGAGGCTGG + Intergenic
1123617210 15:22154250-22154272 CCTGATGGGAAGAATGAGGCTGG + Intergenic
1125611936 15:40977253-40977275 CTGAATGTGCACCATGAGGCTGG + Intergenic
1126048580 15:44667043-44667065 CGGGATGTGCAGACTGAGCCAGG - Intronic
1127830776 15:62749163-62749185 CTGGATGATCAGCATGGGTCTGG + Intronic
1128936615 15:71751245-71751267 ATGGATGAAAAGAATGATGCTGG + Intronic
1129275327 15:74441683-74441705 CTGGGTAAGCAGAAAGAGGGAGG + Intergenic
1129638676 15:77351376-77351398 AAGTATGATCAGAATGAGGCAGG + Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1130798800 15:87239196-87239218 TTGGATGAGGAGATTAAGGCTGG + Intergenic
1131067221 15:89442226-89442248 CTGGAAAAGCAGAAAGGGGCGGG + Intergenic
1131144234 15:90001374-90001396 CTGGAAGAAGGGAATGAGGCAGG - Exonic
1131946448 15:97627348-97627370 CTGGATGATCAAATTGAGGTTGG + Intergenic
1132061129 15:98693217-98693239 CTGGATGAGCAGAATGAGGCAGG + Intronic
1202989432 15_KI270727v1_random:445872-445894 CCTGATGGGAAGAATGAGGCTGG + Intergenic
1132828308 16:1915788-1915810 CTGGATGAGCTGACTGACGGTGG + Intronic
1132975620 16:2709825-2709847 CTGGGTGCCCAGCATGAGGCCGG + Intergenic
1136016998 16:27406749-27406771 CTGGATGCGGAGTGTGAGGCAGG - Intronic
1139003581 16:62543763-62543785 CCAGATGACCAGAGTGAGGCTGG - Intergenic
1139642342 16:68301309-68301331 CTGGATGTGCAGAAGGAGTTCGG - Exonic
1140813646 16:78601221-78601243 CTGGGTGAGTAAAATAAGGCAGG - Intronic
1141138228 16:81480575-81480597 CTGGAGCAGCAGAATGGGTCAGG - Intronic
1141270337 16:82534035-82534057 CTGGGTAATCAGAATGAGGAAGG - Intergenic
1141866735 16:86755508-86755530 CTGGCTTAGCAGAGTGTGGCTGG + Intergenic
1142252028 16:88996424-88996446 CTGGGTGAGCAGGATGGGGCTGG - Intergenic
1142578813 17:927623-927645 CAGGAGGAGCAGAAGGAGGCGGG + Intronic
1142698843 17:1647775-1647797 CAGGCTCAGCAGAATGAGGGAGG + Intronic
1143181354 17:4986334-4986356 CAGGATGAGAAGTATGAGGTAGG + Intronic
1143506639 17:7369598-7369620 CTGGATTAGGAGAGTGAGACTGG - Intergenic
1144421010 17:15098458-15098480 CTTGATGCGGAGAATGAGGGAGG - Intergenic
1144847766 17:18228930-18228952 CTGGATGGGCAGAGGCAGGCAGG + Intronic
1146458319 17:33024317-33024339 GTGGATGAGAATACTGAGGCTGG - Intronic
1146658853 17:34651428-34651450 CTGGAGGAGCAGAACGGGGCTGG + Intergenic
1146747462 17:35345230-35345252 CTGGGTAAGGAGAGTGAGGCAGG - Intergenic
1148496044 17:48054205-48054227 CTGGATGAGCAAGATGCGACAGG + Intronic
1148606379 17:48932386-48932408 GAGGATGAGTAGAATGAGGCAGG - Intronic
1149452587 17:56761362-56761384 CTCGAAGAGCAGAAGTAGGCTGG - Intergenic
1149640023 17:58196789-58196811 CGGGGTGAGCAGCATGAGCCTGG + Intronic
1149656401 17:58311683-58311705 CTGGATGTGCAGATCGAGCCTGG - Exonic
1153035841 18:761641-761663 CTGGATTAAGAAAATGAGGCTGG - Intronic
1153467921 18:5410344-5410366 CTGAATGAGAAACATGAGGCTGG + Intronic
1153597495 18:6742521-6742543 GTGGATGAGCAGATTGTGGATGG + Intronic
1153945044 18:10010565-10010587 GAGAATGAGCAGAATGATGCTGG - Intergenic
1153990738 18:10397210-10397232 CTGGATGAGGAAAGAGAGGCGGG + Intergenic
1157043186 18:44063482-44063504 CTGGAAGAATAAAATGAGGCTGG + Intergenic
1157316520 18:46594387-46594409 CTGGATGAGAAGAAAGCGGATGG - Intronic
1157631144 18:49097302-49097324 CTGGATAAGCAGCATGATTCTGG + Intronic
1157697171 18:49732170-49732192 CTGAATGATGAGAGTGAGGCTGG + Intergenic
1159941797 18:74413939-74413961 CTAAATGAGCAGAAGGAGGCCGG - Intergenic
1161399966 19:4062916-4062938 CTGGATGGGAAGACTGAGGCTGG + Intronic
1161950092 19:7463128-7463150 TTGAAAGAGCAGATTGAGGCAGG - Intronic
1161967493 19:7556552-7556574 CAGGATAAGCAGATTGAGGTAGG + Exonic
1162188436 19:8925712-8925734 ATGGATGGGCAGAATGGAGCTGG + Intronic
1162268773 19:9597184-9597206 CTGAATGAGCAGAATGAGTCAGG + Intergenic
1163096809 19:15064627-15064649 CTTTATTAGCAGAATGAGGATGG - Intergenic
1163326139 19:16604525-16604547 CTGGATGTGCAGGCTGAGGCTGG + Intronic
1163594875 19:18215225-18215247 CAGGGTGTGCAGAATGAGGAAGG - Intronic
1164011768 19:21209922-21209944 CTGCTTGTGCAGAGTGAGGCTGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166944087 19:46386519-46386541 CTGGAAGGGAAGAAGGAGGCCGG + Intronic
925315799 2:2922188-2922210 CTGGAGGGTCAGCATGAGGCTGG - Intergenic
925819267 2:7783550-7783572 CTGGATGAGGGGAAAGAGACAGG + Intergenic
926225013 2:10961249-10961271 CTGGAGGAGCAGAACGAGCCCGG - Intergenic
926862571 2:17324442-17324464 ATGGATGAGGAGAATGGGGATGG - Intergenic
927000288 2:18787904-18787926 ATGTATGAGGAGAATGAGTCAGG + Intergenic
927139100 2:20117865-20117887 CTGGAAGAGCAGGAGGAGCCCGG + Intergenic
927139139 2:20118033-20118055 CTGGAGGAGCAGGAGGAGCCCGG + Intergenic
927139163 2:20118117-20118139 CTGGAGGAGCAGGAGGAGCCCGG + Intergenic
927384199 2:22514498-22514520 CTGGAAGATCAGTATCAGGCAGG - Intergenic
927557602 2:24047171-24047193 GAGGATGAGGAGAATGGGGCGGG - Intronic
927899957 2:26812065-26812087 CTGGAAGACCAGGATGAGGTTGG + Intergenic
928543521 2:32307697-32307719 GTGGATGAGCAGCTTGAGTCAGG + Exonic
932578225 2:72974422-72974444 CTGGATGAGGGGAAGGAGGCTGG - Intronic
935013450 2:99157154-99157176 CTGCATGTGCAGAGTGTGGCAGG - Intronic
935171014 2:100611629-100611651 CTGGCAGGGCAGAATGAAGCTGG + Intergenic
936948777 2:117956107-117956129 CTGGATGAGGAAAATGAGGTAGG - Intronic
937377231 2:121345710-121345732 CTGGAAGAGGTGTATGAGGCAGG - Intronic
937877261 2:126835290-126835312 CTGGGAGAGCAAAATGAGGCAGG - Intergenic
938784740 2:134616317-134616339 TTTGATGAGAAGAATGAGCCAGG - Intronic
939692756 2:145285986-145286008 CTGGAAGAGAAGAGGGAGGCTGG - Intergenic
940323014 2:152397297-152397319 CTGGATGAGCATAATGTAGGTGG + Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942386175 2:175445499-175445521 CTGGGTGTGCAGCATCAGGCTGG + Intergenic
943679103 2:190749080-190749102 CTGGAGGATGAGAGTGAGGCTGG + Intergenic
944844280 2:203653475-203653497 AAAGAAGAGCAGAATGAGGCCGG + Intergenic
945687399 2:212988362-212988384 CTAGATGAGGAAACTGAGGCTGG + Intergenic
946136881 2:217654927-217654949 CTCGATGAGGAAAGTGAGGCTGG + Intronic
946284814 2:218694927-218694949 CTGGAGGAGGAGAACGAAGCAGG - Intronic
946534858 2:220615924-220615946 CTGTATGAGGGGAATGAGACTGG - Intergenic
947639222 2:231696947-231696969 CTGCATGAGGGGAATGAGGTGGG + Intergenic
948112892 2:235471251-235471273 CTGGAGCAGCATAATGAGGATGG + Intergenic
949005489 2:241644480-241644502 ATGGGTGAGGAGACTGAGGCTGG + Intronic
1169080133 20:2793329-2793351 TTGGAAGAGCTGGATGAGGCCGG - Intergenic
1169794186 20:9443620-9443642 CTGCAGGATCAGACTGAGGCTGG + Intronic
1170054743 20:12189260-12189282 CTGGATTTACAGAATGAGTCAGG - Intergenic
1170623732 20:18015022-18015044 CAGAATGAGCAAAATCAGGCCGG + Intronic
1171247697 20:23625912-23625934 CTGGGGGCACAGAATGAGGCTGG - Intergenic
1171824065 20:29878625-29878647 CTGGAGGAGCAGGTTGGGGCGGG - Intergenic
1172113891 20:32562774-32562796 CTGCAGGAGCAGAATGGGGAGGG - Intronic
1173406323 20:42768983-42769005 CTGGGTCATGAGAATGAGGCAGG - Intronic
1174356020 20:49998347-49998369 ATGAATGAGCAGACTGAGGGAGG + Intergenic
1176217233 20:63954007-63954029 CTGGATAACTAAAATGAGGCTGG + Intronic
1177598575 21:23280631-23280653 CTGGAGGAGAAGAATGACCCAGG - Intergenic
1177807693 21:25890194-25890216 GTGGATGAGCAGTGTGAGGAAGG - Intronic
1177854933 21:26390160-26390182 CTGGAAGAGCATGATGAGGTGGG - Intergenic
1178709527 21:34902758-34902780 GTGGATGAGGAGGCTGAGGCTGG - Intronic
1179410992 21:41163082-41163104 CTTGAGGAGCAAAATGAGGCAGG + Intergenic
1182106755 22:27695205-27695227 CAGGAAGAGGAGAAAGAGGCGGG + Intergenic
1183293074 22:37014724-37014746 CTGGAAAAGGAGACTGAGGCTGG + Intronic
1183415862 22:37681511-37681533 ATGGATGAGGAAACTGAGGCTGG - Intergenic
1184555979 22:45233314-45233336 CAGGGTGGGCAGACTGAGGCAGG + Intronic
1185121418 22:48973879-48973901 CTGGAAGAGCAGTAGGAGGGAGG - Intergenic
1185264234 22:49890606-49890628 TTTGATGAGAAGAATGAGCCAGG + Intergenic
949426194 3:3918729-3918751 CTGTAAGAGCAGAGTGAAGCAGG + Intronic
949890723 3:8731999-8732021 CTGGATAAGAAGAAAGAGGAAGG - Intronic
950032647 3:9862707-9862729 CTGGAGGCGCTGAATGGGGCCGG + Intergenic
950162578 3:10771473-10771495 CTGGATAAGAAGACTGAAGCTGG - Intergenic
950675241 3:14550601-14550623 ATGCATGAGGAGATTGAGGCCGG - Intergenic
951135879 3:19103707-19103729 GAGGATGAGCAGAATCAGGGTGG - Intergenic
952530491 3:34257528-34257550 CTTGGTGGTCAGAATGAGGCTGG + Intergenic
954443627 3:50535079-50535101 CTTGAGGAGCAGAATGGGGGAGG - Intergenic
960603286 3:119479262-119479284 ATGGATGAGCAAAATGAGAAGGG - Intronic
961300048 3:125916444-125916466 CAGGATGAGCGTTATGAGGCGGG - Intergenic
961373592 3:126448031-126448053 CTGGATGAGAAAGCTGAGGCAGG - Intronic
961531896 3:127545030-127545052 CTGGGTGAGCAGGAAGAGGAAGG + Intergenic
962319829 3:134381476-134381498 TTGGGAGAGCAGAATGAGGAGGG + Intergenic
962700085 3:137989283-137989305 CTAAGTGAGCAGCATGAGGCTGG - Intergenic
963314609 3:143745929-143745951 CTGGATGAAAAGAAAGAGACAGG + Intronic
964739954 3:159954716-159954738 ATGTATGAACAGAAGGAGGCAGG + Intergenic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968671278 4:1853109-1853131 GGGGAGGAGCAGAATGAGGAGGG - Intronic
969385269 4:6841248-6841270 CTGGAAGAGCAGTTTGAGCCTGG - Intronic
969631791 4:8343254-8343276 CTGGATGAGGAGAAGCAGGGAGG + Intergenic
971287745 4:25306740-25306762 CTGTATGAGCAGGCTGAGGCTGG + Intergenic
971764875 4:30817979-30818001 CTGAGTGAGAAGAATGTGGCAGG - Intronic
972969763 4:44558969-44558991 TTGGAAGATCAGAATGAGGTCGG + Intergenic
973850575 4:54957672-54957694 CTGGTAGGCCAGAATGAGGCAGG - Intergenic
974099709 4:57403266-57403288 CTGGAAGAGCTGAATCAGGCAGG - Intergenic
975890608 4:79022719-79022741 CTGGCTGAGCATAAGGCGGCTGG + Intergenic
977223762 4:94370381-94370403 CTGGAGGCTCTGAATGAGGCAGG + Intergenic
980722151 4:136712301-136712323 CAGGATAAGGGGAATGAGGCAGG - Intergenic
980908382 4:138971559-138971581 CTGGAAGAGGTGAAAGAGGCAGG + Intergenic
980985693 4:139692300-139692322 CTGGGTGAGCAGCAGGTGGCTGG - Intronic
981216624 4:142177084-142177106 CTGAATTAGGAGAAAGAGGCAGG - Intronic
981912749 4:150000739-150000761 CTGGAAAAGCAGAATGGGGTAGG - Intergenic
983365004 4:166775219-166775241 GTGGATGAGGAGAAAGTGGCAGG + Intronic
984006938 4:174323451-174323473 CAGGATGGGCAGAATGTGCCTGG - Intronic
984226360 4:177039982-177040004 CTGAATAAGCACAATAAGGCAGG + Intergenic
985095433 4:186408218-186408240 GTGAATGAGCAGAATGAGCATGG + Intergenic
985222980 4:187727744-187727766 CTGGATGATGGGAAAGAGGCAGG + Intergenic
985818163 5:2141937-2141959 GCGGATGAGCAGATGGAGGCAGG + Intergenic
986552900 5:8978627-8978649 CTGGAGGAGGAGAAAGAGGTGGG - Intergenic
988042844 5:25910939-25910961 CAGGATGAGCAGGATGAGAATGG + Intergenic
989101110 5:37823914-37823936 CTGGCTGAGCTGAATGCTGCTGG - Intronic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
991601368 5:68354564-68354586 CTGGATGAGAGGAAGGAGGTAGG - Intergenic
995164491 5:109023210-109023232 TTGTATGTGGAGAATGAGGCAGG + Intronic
997450377 5:133977781-133977803 TGGGATGAGCAGGCTGAGGCAGG + Intronic
997737993 5:136228557-136228579 CGGGATGAGCAGAATGGAGCAGG + Intronic
998147031 5:139734796-139734818 CTGGATCAGCAGAGGCAGGCAGG - Intergenic
999254266 5:150201114-150201136 CAGCATGAGCAGGATGAGGTAGG - Exonic
1000686760 5:164259379-164259401 CTGGTTGAGAAGATAGAGGCTGG - Intergenic
1001734113 5:173984802-173984824 CTGTATGAGCAGTATGAGAATGG - Intronic
1002378488 5:178806746-178806768 CTGGCTTTGCAGAATGAGTCAGG - Intergenic
1002466591 5:179411838-179411860 CTGGCGGAGCAGGAGGAGGCTGG - Intergenic
1002719125 5:181247148-181247170 CTGGATGAGAAGGAAGAGGCCGG - Intronic
1002853476 6:1017189-1017211 CTGGATGTGCAGAATCACTCTGG - Intergenic
1002931620 6:1638855-1638877 CTGCATGAGTAGAGTGAGTCTGG + Intronic
1003738486 6:8906091-8906113 CTGGCTGAGCAGGAAGTGGCAGG + Intergenic
1007109556 6:39304992-39305014 CTGGATGGGCAGATGGATGCTGG + Intronic
1011259734 6:85458408-85458430 CTGGATGACCAGCTTCAGGCAGG + Intronic
1013183086 6:107734201-107734223 CTTGAGGAGTAGAATGATGCTGG - Intronic
1013795997 6:113889601-113889623 CTGGATAAGGAGAAAGATGCTGG + Intergenic
1015270256 6:131330745-131330767 CTGGAATAGCATAATGAGGGTGG - Intergenic
1015593232 6:134842518-134842540 CTGGATCAGCAGATCCAGGCAGG + Intergenic
1016993429 6:149944877-149944899 CTGGTTGAACAGAGTGAGGATGG - Intronic
1017004904 6:150022653-150022675 CTGGTTGAACAGAGTGAGGATGG + Intronic
1017559233 6:155608873-155608895 CTGGTTGAGGAGGATGAAGCAGG - Intergenic
1018222290 6:161593327-161593349 ATGGATGAGGACAGTGAGGCAGG + Intronic
1019127237 6:169848932-169848954 CTTCTTGGGCAGAATGAGGCTGG + Intergenic
1020005712 7:4782948-4782970 CTGGGTGTGCAGAGTGAGGTGGG + Intronic
1021826766 7:24561237-24561259 CTGGATGTGAGGAATGAGGAAGG - Intergenic
1022298189 7:29077147-29077169 CTGGAGGAGCTGATTGAAGCTGG - Intronic
1022517371 7:30984453-30984475 CTGGATGAGGGGACTCAGGCAGG + Intronic
1023638433 7:42236533-42236555 CGGGATGGGCGGAAGGAGGCGGG - Intronic
1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG + Intergenic
1026875606 7:73877369-73877391 CTGCATGGGGAGACTGAGGCAGG + Intergenic
1027132246 7:75599325-75599347 CTGGAGGAGGAGAAAGGGGCGGG - Intronic
1028445405 7:90916188-90916210 TTGGAAGTGAAGAATGAGGCTGG + Intronic
1028490567 7:91406874-91406896 CTGGCTGAGAAGAAAGATGCTGG - Intergenic
1029192500 7:98781685-98781707 CTGGTTCAGCAGGAAGAGGCTGG + Intergenic
1029618479 7:101675116-101675138 CTGGATGTGCAGAAGGGGGTCGG - Intergenic
1030889513 7:114982176-114982198 CCTGATGTGCAGAATGGGGCAGG + Intronic
1033022946 7:137745509-137745531 CTGCCTGAGCAGAATGGAGCAGG - Intronic
1033532771 7:142282060-142282082 CTGGGTAACAAGAATGAGGCAGG - Intergenic
1033741226 7:144277208-144277230 CTGGAGCAGCAGTTTGAGGCGGG + Intergenic
1033752677 7:144372406-144372428 CTGGAGCAGCAGTTTGAGGCGGG - Exonic
1034728293 7:153360887-153360909 CTGGATGAGAACACTGAGCCTGG - Intergenic
1034940810 7:155229000-155229022 CAGCTTGAGCAGAATGAGACTGG - Intergenic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1036497235 8:9280355-9280377 CTGGGGGAGCAGAATGAGGGAGG + Intergenic
1036651841 8:10649227-10649249 GTGGATGAGGAGAATGAAGAAGG - Intronic
1036950173 8:13132962-13132984 CTTGATGTGCAGAAAGAAGCCGG - Intronic
1037477334 8:19270496-19270518 GTGGATGAGCAGAGAGAGCCAGG + Intergenic
1037719563 8:21431198-21431220 GTGGGTGAGCAGAATCAGGGTGG + Intergenic
1037934295 8:22904251-22904273 CTGGAAGAGGAGAAGGAGCCAGG + Intronic
1038535704 8:28351623-28351645 GTGGAAGAGCAGACAGAGGCAGG + Exonic
1038567823 8:28634548-28634570 CAGGATGGGCAGAAAGAGCCAGG - Intronic
1038577283 8:28716219-28716241 CTGGATGAGGCTGATGAGGCAGG + Exonic
1039485217 8:37904542-37904564 ATGGAGGAGCAGAAAGGGGCTGG + Intergenic
1040551489 8:48440892-48440914 CTGTATGTGCAGAATGTGGACGG - Intergenic
1041963315 8:63645660-63645682 CTGGATGAACAAACAGAGGCTGG + Intergenic
1042540864 8:69906016-69906038 CAGGCTGTGCAGAATGGGGCAGG - Intergenic
1043817595 8:84821590-84821612 CTGGATGAACAGAATGTGATTGG - Intronic
1044731341 8:95230975-95230997 CTGAGAGAGAAGAATGAGGCAGG + Intergenic
1044852426 8:96442104-96442126 CGTGATGAGCAGAGTCAGGCTGG + Intergenic
1045206259 8:100044215-100044237 CAGAATGAGCAGAATGAGTTGGG - Intronic
1045384846 8:101662334-101662356 CTGGGCGAGCAGAAGGAGACTGG - Intronic
1046486535 8:114895117-114895139 CTAGATGAGTATAATGAGGGTGG + Intergenic
1047998521 8:130358405-130358427 CGGCATGAGCAGAGGGAGGCGGG - Intronic
1048182058 8:132204476-132204498 ATGGGGGACCAGAATGAGGCTGG - Intronic
1049399566 8:142418877-142418899 ATGGATGGGGAGACTGAGGCTGG + Intergenic
1049449768 8:142654424-142654446 CTTGCTCAGCAGAATCAGGCTGG - Intergenic
1049812725 8:144582681-144582703 CTGCAGGAGGAGGATGAGGCGGG + Intronic
1049844280 8:144792518-144792540 CTGGAGGAGGAGAAGTAGGCGGG - Exonic
1050452509 9:5798153-5798175 CTGGATGAGAAGAAATAGGATGG - Intronic
1050595352 9:7199456-7199478 CTGGATGGGCAGGAAGAGGAGGG + Intergenic
1051789309 9:20782489-20782511 CTGAAAAAGCGGAATGAGGCAGG - Intronic
1052234177 9:26189456-26189478 CTGGATGAGCTGAATGTTGAAGG + Intergenic
1053102667 9:35384140-35384162 CTGGATGAGTAGAAAGAGTCGGG - Intronic
1054337225 9:63817734-63817756 CTGGAGGAGCAGGTTGGGGCGGG - Intergenic
1055441608 9:76342273-76342295 TTGGATTAGTAGAGTGAGGCTGG - Intronic
1057369729 9:94459544-94459566 GAGGATGAGCAGAATGATGGCGG - Exonic
1058427896 9:104891600-104891622 CTGCATGATCAGAGTGAGACTGG + Intronic
1060093369 9:120764626-120764648 CTGGATGGGCACAATGACACGGG - Exonic
1060379396 9:123152723-123152745 ATGGCTGAGCAGAGAGAGGCGGG + Intronic
1060497267 9:124127742-124127764 ATGGATGAGGAAAGTGAGGCCGG + Intergenic
1060827453 9:126695173-126695195 CTGGAGGAGGAGACCGAGGCTGG - Intronic
1061777423 9:132974772-132974794 CTGGATGACAAGAAGGAGACAGG + Intronic
1062034409 9:134376491-134376513 CTGCCTGAGCAGAGTGTGGCGGG - Intronic
1062324204 9:136004598-136004620 CTGTAACAGCAGAATCAGGCCGG + Intergenic
1062540548 9:137040008-137040030 TCGGATGAGGAGAATGAGGACGG - Exonic
1203377132 Un_KI270442v1:385055-385077 CTGGAGGAGCAGGTTGGGGCGGG - Intergenic
1187415842 X:19092651-19092673 CTGGGTGAGGAGGGTGAGGCTGG - Intronic
1188574924 X:31636475-31636497 CTTGATGAGGCTAATGAGGCAGG + Intronic
1191715481 X:64191118-64191140 CTGGAAGAGCTGCATCAGGCAGG + Exonic
1191740547 X:64432589-64432611 CTGGATGAGCAACCTGAGGCTGG + Intergenic
1191870178 X:65739063-65739085 CAGGATGAGCAGGATGAGAATGG + Exonic
1192225255 X:69222996-69223018 CAGAGTGAGCAAAATGAGGCAGG + Intergenic
1192268859 X:69559599-69559621 TTGGATGTGGAGAATGAGGAAGG + Intergenic
1197629663 X:128843741-128843763 CTGGACGAGAAGAATGAAGCTGG - Intergenic
1198077980 X:133212769-133212791 CTGGGTGACAAGAGTGAGGCGGG + Intergenic
1200140938 X:153902642-153902664 CTGGCTGAGCAGAATGGCACTGG + Intronic
1200227961 X:154429483-154429505 ATAGATGAGAAGACTGAGGCTGG + Intronic