ID: 1132061146

View in Genome Browser
Species Human (GRCh38)
Location 15:98693317-98693339
Sequence AGATTTACCACCCTGTTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 100}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132061138_1132061146 11 Left 1132061138 15:98693283-98693305 CCTTGGAGTAGTGCCATTTCCAT 0: 1
1: 0
2: 0
3: 14
4: 113
Right 1132061146 15:98693317-98693339 AGATTTACCACCCTGTTGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 100
1132061142_1132061146 -2 Left 1132061142 15:98693296-98693318 CCATTTCCATGTAGAGGGGCAAG 0: 1
1: 0
2: 0
3: 15
4: 125
Right 1132061146 15:98693317-98693339 AGATTTACCACCCTGTTGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 100
1132061143_1132061146 -8 Left 1132061143 15:98693302-98693324 CCATGTAGAGGGGCAAGATTTAC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1132061146 15:98693317-98693339 AGATTTACCACCCTGTTGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132061146 Original CRISPR AGATTTACCACCCTGTTGTG GGG Intronic
905043921 1:34981775-34981797 AGCTTTACTACTCTTTTGTGAGG - Exonic
905389834 1:37629293-37629315 AGATTAACCCCTCTCTTGTGAGG - Intronic
913888698 1:124278531-124278553 AGATTTGAAACCCTGTTTTGTGG + Intergenic
914976465 1:152368249-152368271 AGATTAGACACCCTGCTGTGGGG - Intergenic
916375275 1:164147113-164147135 AGATTTGCCACCTTGTACTGTGG - Intergenic
918873158 1:190003333-190003355 AGATGTGCCACCCTGCTCTGTGG - Intergenic
922758397 1:228109371-228109393 AGATATACGCCCCTGTTGGGCGG + Intergenic
1066972865 10:42331527-42331549 ATATTTACCACCATGTTTTTGGG + Intergenic
1067169212 10:43892356-43892378 ACATTTTCTACCCTGCTGTGTGG + Intergenic
1073155475 10:101343121-101343143 AAATTAGCCACCATGTTGTGAGG + Intergenic
1079547645 11:21653649-21653671 AGATTTTCTACCCTGTTGCAGGG + Intergenic
1080963083 11:37182835-37182857 AGATTTTCCTCCTTGTTTTGAGG + Intergenic
1083073628 11:60014044-60014066 ATATTTACCACTCTGTTTGGGGG - Intergenic
1088040483 11:105375505-105375527 AGATTTACCATTCTGGTGTGTGG + Intergenic
1093919832 12:24847317-24847339 AAATGTACCACTCTGGTGTGAGG - Intronic
1094749043 12:33383762-33383784 TGATTCACAACCCTGTTGTGAGG + Intronic
1096849382 12:54425903-54425925 AGATTTCCCAGCCAGCTGTGGGG - Intergenic
1097146890 12:56947868-56947890 AGATGTACCACCCTGATGTTTGG + Intergenic
1101525985 12:105531410-105531432 AGATTTAGCACCATGCTGCGTGG + Intergenic
1104208950 12:126668720-126668742 AGATTAACTTCCCTGTGGTGGGG + Intergenic
1107420069 13:40237907-40237929 AGTTCTGCCACCCTATTGTGGGG + Intergenic
1107628982 13:42323782-42323804 AAATGTCCCACTCTGTTGTGGGG - Intergenic
1109970261 13:69759088-69759110 AGATTTGCCTCCCTGCTGGGAGG - Intronic
1111881453 13:93962164-93962186 GAATTTACAACCATGTTGTGGGG - Intronic
1114264068 14:21061028-21061050 AGATTCACTACCTTGTTGAGAGG + Intronic
1124530998 15:30506430-30506452 AAATGTACCACTCTGGTGTGGGG + Intergenic
1124767657 15:32501265-32501287 AAATGTACCACTCTGGTGTGGGG - Intergenic
1130957859 15:88639698-88639720 AGATTTCCCACACTGCTGTTGGG + Intronic
1131667611 15:94587104-94587126 AAATTAGCCACCCTGTTTTGAGG + Intergenic
1132061146 15:98693317-98693339 AGATTTACCACCCTGTTGTGGGG + Intronic
1134425396 16:14138203-14138225 AATTGTAACACCCTGTTGTGAGG - Intronic
1137028573 16:35501503-35501525 AGATTCTCCACCCTGTTGGCCGG - Intergenic
1144457784 17:15433023-15433045 AGATCTAGGACACTGTTGTGGGG + Intergenic
1148135846 17:45291136-45291158 GGATTCACCACCCTGTCCTGGGG - Intronic
1153464360 18:5372630-5372652 AGATTCACAGCCTTGTTGTGGGG + Intergenic
1153705730 18:7743259-7743281 AAATTTAATACACTGTTGTGAGG + Intronic
1155548843 18:26943471-26943493 AGATTTACCACCCTTCTCTTTGG + Intronic
1166936775 19:46338648-46338670 TGATTTACTCCTCTGTTGTGAGG - Intronic
931185542 2:59947558-59947580 AGATTTACCACCCTGGTTTATGG + Intergenic
933228155 2:79774699-79774721 AATCTTACCACCCTGTTTTGTGG - Intronic
933966316 2:87432202-87432224 ACATTTTCCACTCTGTTGTTTGG - Intergenic
936327481 2:111518283-111518305 ACATTTTCCACTCTGTTGTTTGG + Intergenic
937822191 2:126323191-126323213 AGATTTTCCAGTCTGTTGAGTGG - Intergenic
937859269 2:126695429-126695451 TGCTTCACCAACCTGTTGTGTGG - Intronic
940607552 2:155946190-155946212 AGAAATACCACACTGTTTTGAGG - Intergenic
940739397 2:157490015-157490037 AGTTTAACCCACCTGTTGTGTGG - Intergenic
947017660 2:225639126-225639148 AGCTGTACCAACCTGTTCTGGGG - Intronic
947185034 2:227447193-227447215 ACATTTACCACCATTCTGTGTGG + Intergenic
949552645 3:5123831-5123853 AGATTTACCTGCTTGTTGTTCGG + Intronic
956400881 3:68878507-68878529 ATATTTGCTACCCTCTTGTGGGG + Intronic
958026289 3:88053318-88053340 ATGTTTTCCATCCTGTTGTGGGG - Exonic
958498016 3:94870259-94870281 AAATTTACAATCCTGTTATGAGG + Intergenic
960274022 3:115706381-115706403 AGATTTACTACCCAGCTGGGGGG + Intronic
960791324 3:121434350-121434372 ACATTTATCACTCTGCTGTGTGG + Intronic
963653995 3:148022542-148022564 AGATTTACCACAAAGTTCTGGGG + Intergenic
972343639 4:38174782-38174804 AGATTTACAGCTCTGCTGTGGGG - Intergenic
972668363 4:41189921-41189943 AGATTTTCAACCCTGTGCTGAGG - Intronic
973565138 4:52178164-52178186 AAATTTTCCACCCTTTTCTGAGG - Intergenic
974193784 4:58542604-58542626 AGACTTACCTTCCTCTTGTGTGG + Intergenic
976637956 4:87307028-87307050 AGATTTACTTCCTTGTTTTGGGG + Intronic
976922229 4:90454900-90454922 ATATTTGCCAGCCTGTTGTAGGG + Intronic
977950044 4:102960496-102960518 AGCTTTACCACACTGTTTTTTGG - Intronic
978465603 4:109005440-109005462 ACATTTACAACCCTTTTTTGGGG + Intronic
987819751 5:22947689-22947711 AGAGTTACCACCCCTTTCTGTGG + Intergenic
987893019 5:23907085-23907107 AGGTTTACCACTCTACTGTGGGG + Intergenic
988359856 5:30221982-30222004 AAATTTAACACCCTGTTAAGGGG - Intergenic
988818119 5:34854117-34854139 GGATTTATCACCATGTTTTGTGG - Intronic
990284192 5:54283789-54283811 AGATTTACCAGCCTTTCTTGGGG + Intronic
994852774 5:105077013-105077035 AGATTTCCCAGCCTGATTTGTGG - Intergenic
999185456 5:149703997-149704019 AGATGAACCAACCAGTTGTGGGG - Intergenic
999528177 5:152431201-152431223 AGATTCACAATCTTGTTGTGGGG + Intronic
1006745666 6:36340378-36340400 AGATTTTTCACCCGCTTGTGTGG + Intergenic
1016845164 6:148562135-148562157 TGATTTTCCTCCCTGTTGGGTGG - Intergenic
1018338906 6:162828651-162828673 GGATATAGCACCCTTTTGTGGGG + Intronic
1019406730 7:887905-887927 GGATTAATCACCCTGTGGTGGGG + Intronic
1021343525 7:19492748-19492770 ACATTCATCACCCAGTTGTGTGG - Intergenic
1021496243 7:21277484-21277506 ATATTTACCTTGCTGTTGTGAGG + Intergenic
1022507736 7:30917022-30917044 AGAGTGACCACCCCGATGTGAGG + Intronic
1029327721 7:99824082-99824104 AGAGTCACAACCCTGTTTTGGGG - Intergenic
1031198684 7:118649625-118649647 ATATTTACATCCCTGTTATGAGG - Intergenic
1031433796 7:121707956-121707978 ATATTTATAACACTGTTGTGAGG + Intergenic
1033335804 7:140451358-140451380 AGATTTCCAACCCTGCTTTGTGG - Intergenic
1033613251 7:142986104-142986126 TGATTTTCCACCATATTGTGAGG - Intergenic
1039095790 8:33883551-33883573 AAATGTACCACTCTGGTGTGGGG + Intergenic
1039140551 8:34382839-34382861 AAATTTAGCAAACTGTTGTGCGG + Intergenic
1039325658 8:36482647-36482669 AGATTTATCACCCTATTATCTGG - Intergenic
1039842300 8:41302881-41302903 AGAAAAACCACCCTGCTGTGGGG + Intronic
1044079211 8:87863196-87863218 AGATTTCACTCACTGTTGTGAGG - Intergenic
1046516974 8:115275317-115275339 AGAGGTTCCACCCTGATGTGCGG - Intergenic
1046805083 8:118471835-118471857 AGATCTACCACCCTACTTTGTGG - Intronic
1049072509 8:140367772-140367794 AAATGTACCACCCTGGTATGGGG + Intronic
1049857843 8:144874891-144874913 AGATTTCCCAGCCTGTTTTCTGG + Intergenic
1053739003 9:41120856-41120878 AGCATTACCACCCTTTTGGGTGG - Intergenic
1054793413 9:69276731-69276753 AGCTTAACAACTCTGTTGTGAGG - Intergenic
1057117058 9:92534871-92534893 AGACCTTCCATCCTGTTGTGAGG + Intronic
1059375628 9:113878809-113878831 AGATTCCCAACCCTGTTTTGTGG + Intronic
1061581809 9:131542179-131542201 AAATGTACCACTCTGGTGTGGGG - Intergenic
1189071037 X:37864521-37864543 AGAATTACCACTCTGTTATAAGG - Intronic
1190916900 X:54817718-54817740 AGATCCACCTCCCTGTTTTGGGG + Intergenic
1193475687 X:81962664-81962686 AGGTTTACCTGCCTGTGGTGGGG - Intergenic
1194970415 X:100337167-100337189 AAAATTACCACCCTTTGGTGGGG - Intronic
1196104383 X:111880829-111880851 GGATTTATCATCCTGTTGTTGGG + Intronic
1197881026 X:131166627-131166649 TTATTTACCACCTTGTTCTGGGG - Intergenic
1201573167 Y:15434772-15434794 AGACTGACCACCCTCTGGTGTGG - Intergenic
1201944987 Y:19502084-19502106 AAATTGACCTCCCTGGTGTGAGG + Intergenic