ID: 1132069063

View in Genome Browser
Species Human (GRCh38)
Location 15:98759479-98759501
Sequence CAGAAGAACGGCCCCCCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 97}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132069053_1132069063 29 Left 1132069053 15:98759427-98759449 CCGAAGCACTTCTCTGACTTGGT 0: 1
1: 0
2: 1
3: 12
4: 171
Right 1132069063 15:98759479-98759501 CAGAAGAACGGCCCCCCAGGGGG 0: 1
1: 0
2: 0
3: 7
4: 97
1132069054_1132069063 6 Left 1132069054 15:98759450-98759472 CCGACATTGAAGTACCTTCCCCT 0: 1
1: 0
2: 0
3: 11
4: 166
Right 1132069063 15:98759479-98759501 CAGAAGAACGGCCCCCCAGGGGG 0: 1
1: 0
2: 0
3: 7
4: 97
1132069055_1132069063 -8 Left 1132069055 15:98759464-98759486 CCTTCCCCTGCATTACAGAAGAA 0: 1
1: 0
2: 1
3: 19
4: 225
Right 1132069063 15:98759479-98759501 CAGAAGAACGGCCCCCCAGGGGG 0: 1
1: 0
2: 0
3: 7
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132069063 Original CRISPR CAGAAGAACGGCCCCCCAGG GGG Intronic
900103979 1:974439-974461 CAGATGGTCGGTCCCCCAGGAGG + Exonic
901230158 1:7637292-7637314 CAGAAGCCCGGCCCTGCAGGAGG - Intronic
901303595 1:8217108-8217130 CAGAAGGAGGAGCCCCCAGGTGG + Intergenic
901677778 1:10897047-10897069 CAGAGGAAGGACACCCCAGGTGG - Intergenic
901823372 1:11844720-11844742 CAGAGGAAGGACACCCCAGGTGG + Intergenic
901879150 1:12184182-12184204 CAGTACAGGGGCCCCCCAGGAGG - Intronic
902361937 1:15946679-15946701 CAGGAGAACAGACCCGCAGGAGG + Intronic
903239476 1:21973463-21973485 CAGTAGAACGGAGCCCCATGGGG - Intergenic
903311982 1:22465773-22465795 CAGAAGCCCTGCCCCCCATGGGG - Intronic
903757929 1:25676048-25676070 CAGGAGTAGGGCCACCCAGGGGG - Intronic
905258333 1:36700105-36700127 CAGGAGAATGGCTCCCCTGGAGG - Intergenic
911701027 1:100951790-100951812 CAGAAGAATGGCCCCAAAGATGG + Intronic
922573636 1:226647843-226647865 CAGAAGAAGTGCCACCCAGGTGG - Intronic
923825813 1:237499047-237499069 CAGGAGAACGACCCCCAAGAAGG - Intronic
1063249458 10:4258172-4258194 CAGGAGAACAGCCCTCCTGGAGG - Intergenic
1064861909 10:19835668-19835690 CTGAGGAATGGGCCCCCAGGCGG + Intronic
1070396217 10:76013202-76013224 CAGGAGAATGGCTGCCCAGGTGG + Intronic
1070798508 10:79231027-79231049 CAGAGCAAAGGCACCCCAGGAGG - Intronic
1072139013 10:92573732-92573754 CGGAAGAGCGGCTCGCCAGGCGG - Intronic
1077378332 11:2215937-2215959 CAGGAGAGCAGCCACCCAGGAGG + Intergenic
1080871033 11:36237182-36237204 CAAAAGAGCAGGCCCCCAGGTGG - Intergenic
1081675725 11:44967907-44967929 CAGAAGCACGTCTCCCCTGGTGG - Intergenic
1084656777 11:70524226-70524248 CAGCTGCACTGCCCCCCAGGGGG - Intronic
1084658865 11:70535690-70535712 CAGGAGGATGGCCACCCAGGGGG + Intronic
1084670173 11:70601904-70601926 CAGGAGACCTGCCACCCAGGTGG + Intronic
1088972187 11:114783332-114783354 CAGAAAAAGGGCCCCTCAGGTGG - Intergenic
1090936692 11:131349229-131349251 GAGAAAAAAGGACCCCCAGGAGG - Intergenic
1092821509 12:12357409-12357431 CAGAAGAACGGCGGGCCGGGCGG - Exonic
1100674381 12:96850261-96850283 CAGGACAATGGCCTCCCAGGAGG + Intronic
1100817706 12:98401705-98401727 CAGAGAAATGGCCCCCCGGGAGG + Intergenic
1101651495 12:106681499-106681521 CAGTACAAAGGCCCCCCATGGGG + Intronic
1103981719 12:124741155-124741177 CAGAAGAGAAGCCTCCCAGGAGG + Intergenic
1104485458 12:129148259-129148281 CAGAATAATGGCCCCCAAAGAGG + Intronic
1104975066 12:132548594-132548616 CAGAAGGAGAGCCCCCCCGGAGG - Intronic
1105695181 13:22881485-22881507 CAGGAGAAGGGCCCCCCACCAGG + Intergenic
1106527368 13:30553209-30553231 CAGAAGAATGACCCCCCGGAAGG - Intronic
1114212173 14:20624764-20624786 CAGTAGCACGGCTCCCCAGAGGG - Intergenic
1115564336 14:34612272-34612294 CTGAACAATGGCTCCCCAGGAGG + Intronic
1121548530 14:94780678-94780700 CAGAAGAACGATCCCAGAGGTGG + Intergenic
1127901995 15:63347829-63347851 CTGATGAACGGACCCCCAGATGG - Intronic
1129388793 15:75210228-75210250 GAGAAAAACGGCCCCCAAGGTGG - Intronic
1130334851 15:82950009-82950031 CAGAAGAAGGGGCCCCTAGTAGG + Intronic
1132069063 15:98759479-98759501 CAGAAGAACGGCCCCCCAGGGGG + Intronic
1133171611 16:3985617-3985639 CAGAAGGACGGCAGCCCACGTGG - Intronic
1134070860 16:11258917-11258939 CAGCAGAACAGCCCACAAGGTGG - Intronic
1134482647 16:14632664-14632686 TACAAGAACAGCCGCCCAGGAGG + Intronic
1134484278 16:14644865-14644887 CAGAAGATCCACCCCCAAGGAGG - Intronic
1138472936 16:57252556-57252578 CTGGGGAAGGGCCCCCCAGGTGG - Exonic
1139752082 16:69115058-69115080 CAGGAGAACTGCCACCCAGATGG - Exonic
1139823274 16:69737613-69737635 CAGAAAAGCAGCCACCCAGGTGG - Intergenic
1140279928 16:73544788-73544810 CAGAAGAAGTGTCCCCCAGGTGG - Intergenic
1140596326 16:76419276-76419298 GAGAAGTACTGCCCCCCAGTTGG + Intronic
1142496949 17:310919-310941 CAGAGGCACTGCCCCCCTGGGGG - Intronic
1142850115 17:2700755-2700777 CAGCTGGACAGCCCCCCAGGCGG - Exonic
1150546617 17:66165057-66165079 CAGAAGAAAGGTCTCCCATGTGG + Intronic
1151212995 17:72558841-72558863 CAGAAGAGCTGCCTTCCAGGGGG + Intergenic
1151347894 17:73514526-73514548 CAGCAGAATGGCTCCACAGGAGG - Intronic
1152592328 17:81219824-81219846 CTGAACAACAGCCCTCCAGGAGG + Intronic
1157335483 18:46734290-46734312 CCAATGAAAGGCCCCCCAGGTGG - Intronic
1158953948 18:62522908-62522930 GAGAAAGGCGGCCCCCCAGGGGG + Intergenic
927208742 2:20626024-20626046 CAGTGGAACTGCCCGCCAGGCGG - Intronic
928158207 2:28895223-28895245 CAGAAGGAAGCCGCCCCAGGGGG - Intronic
933735598 2:85491453-85491475 CAGAAGACATGGCCCCCAGGAGG + Intergenic
935730992 2:106065210-106065232 CAGAAGCAAGGCCCCCAAGCAGG + Intronic
945251247 2:207768171-207768193 CACACGAACGGGCCCCCAGCGGG + Exonic
1171425605 20:25046776-25046798 CAACTGAGCGGCCCCCCAGGTGG - Intronic
1172508068 20:35478983-35479005 CAGAAGACCTGCCCCTAAGGAGG - Intronic
1172661461 20:36572090-36572112 CAGAAGAGGGGAGCCCCAGGGGG - Intergenic
1176008630 20:62880239-62880261 CAGCTGAAAGGCCCCCGAGGCGG - Exonic
1179101115 21:38356239-38356261 CAGAGGAACTCCCGCCCAGGAGG - Intergenic
1179469185 21:41599174-41599196 CAGAAGAACAGATCCCCAGATGG + Intergenic
1184562042 22:45269069-45269091 CAGAAGAATGCCCTCTCAGGGGG - Intergenic
1184727428 22:46355094-46355116 CAGCAGCACGGCCCCCCTCGAGG - Intronic
950491042 3:13305297-13305319 CAGAAGAGCAGTCCCACAGGTGG + Intergenic
961574192 3:127821792-127821814 CAGAGGAAAGTTCCCCCAGGCGG - Exonic
964395517 3:156241624-156241646 CAGAAGCACGCAGCCCCAGGGGG - Intronic
967341429 3:188403104-188403126 CAGAAGATGGGCCTCTCAGGAGG + Intronic
968876237 4:3269306-3269328 CAGCAGCAGGGCCACCCAGGAGG + Intronic
975696954 4:77023026-77023048 CAGAGTAACTGCCCACCAGGAGG + Intronic
990174677 5:53093582-53093604 GAGAAATACTGCCCCCCAGGAGG - Exonic
990867116 5:60391793-60391815 CAGAATAATGGCCCCCAAAGAGG - Intronic
1001102757 5:168827734-168827756 CAGGACAAGGGCTCCCCAGGCGG + Intronic
1004646337 6:17565029-17565051 CAGGAGAATGGCAACCCAGGAGG + Intergenic
1007660502 6:43482559-43482581 CAGAAGAAGGGCACTCAAGGGGG - Intronic
1017707883 6:157140687-157140709 AAGAAGAAAGGCCTCCCAGGAGG - Intronic
1017770367 6:157639652-157639674 CAGAGGAAAGGCCCCCACGGGGG + Intronic
1021640729 7:22733895-22733917 CAGAAGAACTCCTCCCCTGGAGG - Intergenic
1023915954 7:44589399-44589421 CAGATGAAAGGCCCCTCAGGAGG + Intergenic
1028718375 7:94000698-94000720 CAGAAAAACGGAGCCCCAAGAGG + Intronic
1029028695 7:97446002-97446024 CAGAAGAGCGGCCCATGAGGAGG - Intergenic
1029382077 7:100221018-100221040 CACCAGGACGGCCCCCCATGGGG - Exonic
1038301693 8:26356324-26356346 CAGAAAAACGGGCACCCAGGAGG - Intronic
1038457448 8:27686570-27686592 CAGCAGCCTGGCCCCCCAGGAGG - Intergenic
1038542703 8:28402470-28402492 CGGGAGAGCGGCGCCCCAGGCGG - Intronic
1040877217 8:52166369-52166391 CAGAAGAACAGTGCCCCAGAGGG - Intronic
1043376421 8:79654798-79654820 CAGAATAACGGCCCACCAATTGG - Intronic
1049316618 8:141972563-141972585 CAGAAGAACGTGTCCACAGGAGG - Intergenic
1053142399 9:35690024-35690046 CAGAAGCACGGCCCGGCCGGGGG + Exonic
1055363312 9:75518626-75518648 CAGGAGAATGGCAACCCAGGAGG + Intergenic
1060877120 9:127091507-127091529 CAGGAGAAGGGACCCTCAGGGGG + Intronic
1062190165 9:135243882-135243904 CAGCAGAGCTGCCCGCCAGGCGG - Intergenic
1062281725 9:135754885-135754907 CAGCAGGCAGGCCCCCCAGGAGG - Intronic
1062623095 9:137431365-137431387 CAGAAGCACCGACCCCCAGCAGG - Intronic
1187854939 X:23627755-23627777 CAGAAGAAAGGCCCCGCATCGGG + Intergenic
1194854892 X:98916090-98916112 CAGAACAACGGCCTACCTGGGGG - Intergenic