ID: 1132069097

View in Genome Browser
Species Human (GRCh38)
Location 15:98759902-98759924
Sequence GTCTCACGGTACCACGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 125}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132069097 Original CRISPR GTCTCACGGTACCACGGGAC AGG (reversed) Intronic
900780235 1:4613256-4613278 GGCTCATGGTAACAAGGGACGGG - Intergenic
904624366 1:31793746-31793768 CTCCCACGGAACCACAGGACAGG - Exonic
905675324 1:39820637-39820659 CTCCCTCGGCACCACGGGACTGG - Intergenic
907313862 1:53555036-53555058 GGCTCAGGGACCCACGGGACTGG + Intronic
909133653 1:71769685-71769707 GACTCATGGTTCCACAGGACTGG - Intronic
909694715 1:78453880-78453902 GACTCACAGTTCCACGTGACTGG - Intronic
911090467 1:94013340-94013362 GTCTCAGGGGTCCACGGGTCTGG + Intronic
917477058 1:175377988-175378010 GTCTCACATTCCCAGGGGACAGG + Intronic
917894765 1:179477383-179477405 GTCTCACAGTTCCACGTGGCTGG + Intronic
918039339 1:180903117-180903139 GACTCACAGTTCCACGTGACTGG + Intergenic
923762328 1:236858190-236858212 GACTCACGGTTCCACGTGGCTGG + Intronic
923915614 1:238500343-238500365 GACTCACAGTTCCACGTGACTGG - Intergenic
1071721238 10:88148535-88148557 GTCTCACGGTTCCACGTGGCTGG + Intergenic
1073804393 10:107081262-107081284 GTCTCAGGTTACCACGTCACAGG + Intronic
1075079482 10:119373545-119373567 GACTCACAGTTCCACGTGACTGG - Intronic
1075550969 10:123391953-123391975 GTCTGGCAGCACCACGGGACTGG + Intergenic
1078857356 11:15217124-15217146 GGCTCACAGTTCCACAGGACTGG + Intronic
1081303315 11:41479888-41479910 GACTCACAGTTCCACGTGACTGG - Intergenic
1084447743 11:69213508-69213530 GACTCACTGTCCCACGGGGCTGG + Intergenic
1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG + Intergenic
1089667775 11:120031299-120031321 GTCTCACTGGAGAACGGGACAGG - Intergenic
1092408289 12:8235668-8235690 CTCTCACGGTACCACAGGCCTGG - Intergenic
1093014903 12:14145856-14145878 GACTCACAGTTCCACAGGACGGG + Intergenic
1093646160 12:21587599-21587621 GTCTCACAGTTCCACAGGGCTGG - Intronic
1097575524 12:61388549-61388571 GACTCACAGTACCACAGGACTGG + Intergenic
1098672526 12:73248996-73249018 GACTCACAGTTCCACGTGACTGG + Intergenic
1098830941 12:75361584-75361606 GACTCATGGTTCCACGTGACTGG + Intronic
1104386004 12:128352202-128352224 GACTCACAGTTCCACGGGGCTGG + Intronic
1106929986 13:34653207-34653229 GACTCACAGTTCCACGTGACTGG - Intergenic
1109679491 13:65731203-65731225 GTCTCACAGTTCCACGTGGCTGG - Intergenic
1110416004 13:75253453-75253475 GTCTCTCGGTAGCAGGGGACAGG + Intergenic
1110461853 13:75753765-75753787 GACTCACAGTTCCACAGGACTGG - Intronic
1111911902 13:94322284-94322306 GACTCACAGTTCCACGTGACTGG - Intronic
1113649236 13:112023741-112023763 GACTCACAGTTCCACGTGACTGG + Intergenic
1115157731 14:30359769-30359791 GACTCACGGTTCCACGTGGCTGG + Intergenic
1122440776 14:101730472-101730494 GACTCACAGTTCCACGGGCCTGG - Exonic
1122792332 14:104189264-104189286 GCCTCACAGTGCCACGGGGCTGG + Intergenic
1128874937 15:71194123-71194145 GACTCACAGTACCACGTGGCTGG - Intronic
1132069097 15:98759902-98759924 GTCTCACGGTACCACGGGACAGG - Intronic
1133325548 16:4940144-4940166 GTCTCACTCTACCACCGGGCTGG + Intronic
1134380692 16:13722087-13722109 GACTCACAGTTCCACGTGACTGG - Intergenic
1135170350 16:20178283-20178305 GACTCACGGTTCCACGTGGCTGG - Intergenic
1135386288 16:22043914-22043936 GACTCACAGTTCCACGTGACTGG + Intronic
1140278216 16:73530089-73530111 GTCTCACAGTTCCACGTGGCTGG + Intergenic
1148244313 17:46020587-46020609 GACTCACAGTTCCACGTGACTGG + Intronic
1155192124 18:23439245-23439267 GACTCACAGTTCCACGGGGCTGG - Intergenic
1159528004 18:69618537-69618559 GACTCACGGTTCCACGTGGCTGG + Intronic
1160435213 18:78846490-78846512 GACTCACAGTGCCACAGGACTGG - Intergenic
1161530708 19:4787234-4787256 GTATCCCGGTACCACTGGGCAGG + Intergenic
1165371586 19:35410687-35410709 GACTCACAGTTCCACGGGGCTGG + Intergenic
1166596818 19:44057790-44057812 GTCTCAGGGTACCATGGAGCAGG + Intronic
1167599358 19:50445324-50445346 GTCTCAAGGTACCAAGGTATTGG - Intronic
927376168 2:22417259-22417281 GTCTCACAGTTCCACGTGGCTGG + Intergenic
929164291 2:38865459-38865481 GACTCACAGTACCACAGGGCTGG - Intronic
929963123 2:46511320-46511342 GCCTCAGGGCACCAGGGGACTGG + Intronic
935239961 2:101169658-101169680 GACTCACGGTTCCACGTGGCTGG - Intronic
936588532 2:113780599-113780621 GACTCACAGTTCCACGTGACTGG + Intergenic
936813894 2:116435762-116435784 GACTCACAGTACCACAGGACTGG - Intergenic
940728305 2:157361030-157361052 GACTCACAGTTCCACGTGACTGG - Intergenic
943488682 2:188521462-188521484 GACTCACAGTTCCACGGGGCTGG + Intronic
944472702 2:200072100-200072122 GACTCACAGTTCCACAGGACTGG + Intergenic
947527665 2:230889133-230889155 GACTCACGGTTCCACGTGGCTGG + Intergenic
947907876 2:233778849-233778871 ATCTCACGGTTCCACTGGCCAGG + Intronic
1169549258 20:6685355-6685377 GTCTCACGGCATCATGGGCCTGG - Intergenic
1170338288 20:15295227-15295249 GTCTCACAGTTCCACATGACTGG - Intronic
1170735986 20:19014640-19014662 GACTCACGGTTCCACGTGGCTGG + Intergenic
1175746871 20:61463180-61463202 GACTCACAGTTCCACGTGACTGG - Intronic
1176658023 21:9605391-9605413 GACTCACAGTTCCACAGGACTGG - Intergenic
1178793532 21:35722322-35722344 GACTCACAGTTCCACGTGACTGG + Intronic
1178809441 21:35867868-35867890 GACTCACAGTTCCACGTGACCGG + Intronic
1179457454 21:41508722-41508744 GTCTCTCGGCACCACCGGCCAGG + Intronic
1181243724 22:21491796-21491818 GTCTCAGGGTACCAGGTGTCTGG - Intergenic
1182293304 22:29298595-29298617 GCCACACGGAAACACGGGACAGG + Intronic
1184124679 22:42478759-42478781 GACTCACGGTTCCACGTGGCTGG - Intergenic
952298675 3:32084989-32085011 GACTCACAGTTCCACGTGACTGG + Intergenic
953606924 3:44418375-44418397 GACTCACAGTTCCACGTGACTGG - Intergenic
955014540 3:55057199-55057221 GACTCACGGTTCCACGTGGCTGG - Intronic
955745569 3:62136806-62136828 GACTCACAGTTCCACGTGACTGG - Intronic
955869179 3:63418589-63418611 GACTCACAGTTCCACGTGACTGG + Intronic
957142904 3:76384608-76384630 GACTCACAGTTCCACAGGACTGG + Intronic
957337745 3:78853762-78853784 GACTCACAGTTCCACGTGACTGG + Intronic
957405724 3:79773879-79773901 GTCTCGAGGAACCACGGGTCAGG + Intergenic
958084313 3:88786916-88786938 GACTCACAGTACCACATGACTGG + Intergenic
960660610 3:120053885-120053907 GACTCACAGTTCCACGTGACTGG - Intronic
961887238 3:130104233-130104255 CTCCCACGGTACCACAGGCCTGG - Intronic
963510156 3:146236684-146236706 GTCTTACGGTTCCACATGACTGG - Intronic
966194289 3:177298036-177298058 GTCCCATGGCACCACGGGAAAGG - Intergenic
968541742 4:1171600-1171622 GTGTCACGGTCCGACGTGACTGG - Intronic
971393073 4:26203972-26203994 GTCTCACTCTCCCACGGGGCTGG + Intronic
974214626 4:58828986-58829008 GTTTCACAGTTCCACAGGACTGG + Intergenic
977122144 4:93115651-93115673 GACTCACAGTTCCACAGGACTGG + Intronic
978817603 4:112926919-112926941 GACTCACAGTTCCACAGGACTGG + Intronic
981645688 4:146996086-146996108 GACTCACAGTTCCACGTGACTGG - Intergenic
984065917 4:175047983-175048005 GGCTCACGGTTCCACATGACTGG - Intergenic
985417388 4:189750682-189750704 GACTCACAGTTCCACAGGACTGG + Intergenic
987651074 5:20740707-20740729 GACTCACGGTTCCACGTGGCTGG + Intergenic
988744487 5:34120759-34120781 GACTCACGGTTCCACGTGGCTGG - Intronic
989289900 5:39750989-39751011 GACTCACAGTTCCACGTGACTGG - Intergenic
993711678 5:91231277-91231299 GACTCACAGTTCCACAGGACTGG + Intergenic
994494267 5:100489631-100489653 GACTCACAGTACCACGTGGCTGG + Intergenic
995608010 5:113879217-113879239 GGCTCACAGTTCCACAGGACTGG - Intergenic
995860558 5:116636201-116636223 GACTCACAGTTCCACGTGACTGG + Intergenic
997826648 5:137112474-137112496 GGCTGACTGTGCCACGGGACAGG + Exonic
1000573893 5:162951928-162951950 GACTCACAGTTCCACGTGACTGG + Intergenic
1001724529 5:173885931-173885953 GACTCACAGTTCCACGTGACTGG - Intergenic
1003897832 6:10624286-10624308 GACTCACAGTTCCACGTGACTGG + Intronic
1005180070 6:23094707-23094729 GACTCACAGTTCCACCGGACTGG - Intergenic
1005632219 6:27719091-27719113 GACTCACAGTTCCACGTGACTGG + Intergenic
1009474772 6:64076686-64076708 GACTCACAGTTCCACGGGGCTGG - Intronic
1015240923 6:131022328-131022350 GTGTCACGTTACCATGTGACAGG - Intronic
1016311311 6:142736712-142736734 GACTCACGGTTCCACGTGTCTGG + Intergenic
1018229633 6:161663150-161663172 GACTCACAGTTCCACGTGACTGG - Intronic
1018473896 6:164121847-164121869 GGCTCACAGTTCCACGGGGCTGG + Intergenic
1020015645 7:4829834-4829856 GGCTCACAGTTCCACGTGACTGG - Intronic
1020932600 7:14416700-14416722 GACTCACAGTTCCACGGGGCTGG - Intronic
1025019413 7:55468776-55468798 GCCCCAGGGTACCACGGGACAGG + Intronic
1026224798 7:68430801-68430823 GACTCACGGTTCCACAGGGCTGG - Intergenic
1029048962 7:97663390-97663412 GACTCACAGTTCCACGTGACTGG + Intergenic
1034516977 7:151588773-151588795 GACTCACAGTTCCACGTGACTGG - Intronic
1034902361 7:154915352-154915374 GTCTTAAGGTACCTAGGGACTGG - Intergenic
1036848699 8:12186767-12186789 CTCCCACGGTACCACAGGCCTGG - Exonic
1036870060 8:12429048-12429070 CTCCCACGGTACCACAGGCCTGG - Exonic
1037733400 8:21548182-21548204 GACTCACAGTTCCACGGGGCGGG + Intergenic
1047823976 8:128553068-128553090 GACTCACAGTTCCACGTGACTGG + Intergenic
1047899617 8:129405906-129405928 GACTCACAGTACCACGTGGCTGG + Intergenic
1048551940 8:135441655-135441677 GACTCACAGTTCCACGTGACTGG + Intergenic
1050964581 9:11782678-11782700 GACTCACTGTACCACATGACTGG + Intergenic
1055626053 9:78178603-78178625 GTCCCACGGTGCCACGGGAAAGG + Intergenic
1056118399 9:83463357-83463379 GACTCACAGTTCCACAGGACTGG + Intronic
1203635752 Un_KI270750v1:108966-108988 GACTCACAGTTCCACAGGACTGG - Intergenic
1187663048 X:21572523-21572545 GACTCACAGTTCCACAGGACTGG + Intronic
1194253832 X:91612700-91612722 GACTCACAGTTCCACAGGACTGG + Intergenic
1200035773 X:153328856-153328878 GACTCACAGTTCCACGTGACCGG + Intergenic
1200572617 Y:4852277-4852299 GACTCACAGTTCCACAGGACTGG + Intergenic