ID: 1132070177

View in Genome Browser
Species Human (GRCh38)
Location 15:98769673-98769695
Sequence GGTTTAATTAGACCAGGATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 107}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132070172_1132070177 29 Left 1132070172 15:98769621-98769643 CCACATTGAATAAGAAATAATTT 0: 1
1: 0
2: 1
3: 43
4: 601
Right 1132070177 15:98769673-98769695 GGTTTAATTAGACCAGGATATGG 0: 1
1: 0
2: 0
3: 8
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132070177 Original CRISPR GGTTTAATTAGACCAGGATA TGG Intronic
903196922 1:21696997-21697019 GGTTTAATTAAATCTGGATGAGG + Intronic
905749169 1:40447061-40447083 AGTTTACTTTGACTAGGATACGG + Intergenic
911775708 1:101809358-101809380 GGTAGAATTAGACCAGAATTGGG + Intronic
912156327 1:106924890-106924912 GATTTAATAAGTCCAGGATGGGG + Intergenic
915382781 1:155458080-155458102 TGTTTACCTAGACCAGGGTAAGG - Intronic
916417256 1:164603448-164603470 GGTATAATTATACCTGGATATGG + Intronic
917451729 1:175152841-175152863 GGTTGAATTAGAGAAGGAGAAGG + Intergenic
922647921 1:227309751-227309773 AGCTTAATTAGAGCAGGAAAAGG + Intronic
1063529551 10:6818306-6818328 TGTTTAATTAAACAAGGAAAAGG + Intergenic
1064771331 10:18726734-18726756 GGTTTAATTAAAATGGGATAGGG - Intergenic
1065171173 10:23031339-23031361 TGTTTAATTACACCAGGTAAAGG + Intronic
1066436547 10:35401208-35401230 GGTTTAATAAGAATAGAATAGGG + Intronic
1067295399 10:44972691-44972713 TGTTGAATTAGACCAAGATAGGG - Intronic
1068729594 10:60341815-60341837 TTTTTAAGTAGACCACGATAGGG + Intronic
1070951981 10:80438573-80438595 GGTTTAACTGGACTAGGATCTGG - Intergenic
1071016595 10:81004748-81004770 AGTTTAATTAGATCAGAATGGGG - Intergenic
1076228372 10:128799434-128799456 GATTTAAATAGACCAGTATGAGG - Intergenic
1078469225 11:11573742-11573764 GGTTTATTGAGACCATGATGAGG - Intronic
1081343288 11:41953550-41953572 GGTTTAATTAGTCCTTGATGGGG - Intergenic
1085144402 11:74180391-74180413 GGGTTAAATAGGCCAGGATTTGG - Intronic
1087269514 11:96097339-96097361 GGTTTAAATAGAGAAGGATGGGG + Intronic
1087457323 11:98403432-98403454 GGTTTATTTAGCCAAGGATGAGG + Intergenic
1089276188 11:117337581-117337603 AGCTTAATAGGACCAGGATATGG - Intronic
1090728142 11:129545955-129545977 GTTTTAACTGGTCCAGGATATGG + Intergenic
1092215421 12:6678530-6678552 GGGTTAATTAGACAATGATCTGG - Intronic
1094047698 12:26185495-26185517 GGTATAATCAGACCAGTACAAGG - Intronic
1094227972 12:28067634-28067656 GGTGTAATTGGGCCAGGTTATGG - Intergenic
1095728267 12:45475557-45475579 GATTACATAAGACCAGGATATGG - Intergenic
1095790254 12:46159229-46159251 GATTTAATTAGACAAGGAAGAGG + Intergenic
1098241898 12:68476532-68476554 GGTTGAATTAGTTCAGGTTAGGG - Intergenic
1102127815 12:110499988-110500010 GGTTTAATTATTCAAGTATATGG + Intronic
1107294273 13:38893448-38893470 GGTTTATTTAGCCAAGGTTAAGG + Intergenic
1108915690 13:55608041-55608063 GGTTTACTCAGCCCAGAATAAGG - Intergenic
1113021795 13:105895651-105895673 TGTTTACTTACACCAGGAGAAGG + Intergenic
1114315942 14:21510194-21510216 GGTCTAATTAGACAAAAATAAGG - Intronic
1116366282 14:44069039-44069061 GGTCTAATTAGAACTAGATAGGG - Intergenic
1116833433 14:49745343-49745365 GATTTAATTAGTCCAGGGTGTGG + Intronic
1117587349 14:57223796-57223818 GGTTTTTTTAGCCCAGAATATGG - Intronic
1118858548 14:69643544-69643566 GGTTTAATGGGACCATGATCAGG - Intronic
1119551385 14:75516381-75516403 TATTTAATTAGAGCAGTATAAGG + Intergenic
1120221169 14:81735470-81735492 GATTTAATTAGAGAAAGATAAGG - Intergenic
1124844580 15:33277997-33278019 GGTTTAATTAGACAGGGTTATGG + Intergenic
1129119492 15:73387374-73387396 GGTTTATTTAGCCAAGGTTAAGG + Intergenic
1132070177 15:98769673-98769695 GGTTTAATTAGACCAGGATATGG + Intronic
1143829775 17:9641867-9641889 GGCTTATTTAGACGAGGACATGG + Intronic
1149272986 17:55002546-55002568 GTGTTAATCAGAGCAGGATATGG + Intronic
1149300566 17:55301546-55301568 GCTTGAATTAGACCTTGATATGG + Intronic
1149817217 17:59737205-59737227 GGTTTAATAAGATCAGGCTTTGG + Intronic
1151273396 17:73014301-73014323 GGGTTAATTGCACCGGGATAGGG - Intronic
1154935719 18:21054412-21054434 GGTTTTATTAGAGCAGGAGTTGG - Intronic
1157189863 18:45571988-45572010 GGTTTAATTGGTCCAGGATGGGG - Intronic
1157791242 18:50533056-50533078 GGTTGAACTGGTCCAGGATATGG - Intergenic
1158648475 18:59267491-59267513 AGTTTATTTAGACGAGGAAAGGG + Exonic
1159384780 18:67709545-67709567 GGTTTCATTAGAACAAAATAAGG + Intergenic
1159692282 18:71504168-71504190 GGTTTAATTATACGAGGGAAAGG + Intergenic
1162297875 19:9825943-9825965 GGTTTATGTAGACAAGGTTAAGG - Intronic
925924293 2:8659367-8659389 TGTTTTATCAGACCAGGAGATGG - Intergenic
928095528 2:28402551-28402573 GGTCTGATTGGACCAGCATAGGG + Intronic
928414141 2:31077695-31077717 GGTTTAATTAGAGACAGATAAGG - Intronic
930970693 2:57391746-57391768 GCTTCAATTAGACCAGGAAAAGG + Intergenic
932168419 2:69530502-69530524 GGGGTAAGTAGACCATGATATGG + Intronic
932958612 2:76385960-76385982 GGTTTAATGAAACCATGATTAGG + Intergenic
939762942 2:146207164-146207186 AGATTAATTAAACAAGGATATGG - Intergenic
939846436 2:147252112-147252134 GGTTTAATTGGTCCAGCATGGGG - Intergenic
940689364 2:156896190-156896212 GGTTTAATTAGAGGAGGATGAGG + Intergenic
941519751 2:166525845-166525867 GGTTTAATTACACCAAGCCATGG + Intergenic
943023778 2:182605158-182605180 GGTCTAATTGGACCAGGGCAGGG - Intergenic
944699854 2:202237481-202237503 TGTTTAATTAGAACAGGATGAGG + Intronic
946252648 2:218422989-218423011 GATTTAATTAGGCCAGGGTGGGG - Intronic
1173938710 20:46891697-46891719 GGTTTAATTGGTCTAGGATGGGG + Intergenic
1177644754 21:23887162-23887184 GTTTTTATAAGCCCAGGATAGGG - Intergenic
1182027051 22:27128484-27128506 GGTTTTATCTCACCAGGATATGG + Intergenic
949971394 3:9408445-9408467 GGTTCCATTTGATCAGGATAAGG + Intronic
951383925 3:22021848-22021870 GATTTAATTAGTCTAGGATGCGG + Intronic
958821421 3:98977960-98977982 GGTTTTTTTAGACCATGATCTGG + Intergenic
960062863 3:113341133-113341155 GTTTTAATAGGCCCAGGATAGGG + Intronic
961157076 3:124689024-124689046 GGTTTTATTTGACCAGCAGAGGG - Intronic
965173283 3:165296293-165296315 TGTTTAATTAAATCAAGATATGG + Intergenic
965553224 3:169991760-169991782 GGATAAATTAGCCCTGGATAAGG - Intronic
967414703 3:189203189-189203211 GTTATACTTAGACCAGGATCTGG + Intronic
967756519 3:193176390-193176412 GGTTTAATAGCATCAGGATAGGG - Intergenic
967815338 3:193793547-193793569 GGTTTAATTAGCCCAAGCTCAGG - Intergenic
973101350 4:46275150-46275172 GGTTTAATGAGACCAGAAATAGG - Intronic
975272661 4:72454676-72454698 GGTTGAAGAAGACCAGGAGAAGG + Intronic
978827009 4:113037302-113037324 GTTTTAATTAGAACAGCTTAAGG + Intronic
981477209 4:145198951-145198973 TGTTTAAGTAGAGCAGCATAAGG + Intergenic
982360991 4:154518869-154518891 AGTCTAATTAGAGCAGGATAGGG - Intergenic
982539123 4:156645225-156645247 GATTTAAAGAGACCAGGGTAAGG - Intergenic
986876931 5:12122636-12122658 GGTTGAATTTGACCAAGATTTGG - Intergenic
986962517 5:13232480-13232502 GGGGTAATTAGAATAGGATATGG + Intergenic
990666918 5:58082916-58082938 GTGTTGATTAGACCTGGATAAGG + Intergenic
993467493 5:88267271-88267293 AGTGAAATTAGACAAGGATAGGG - Intronic
994006791 5:94846709-94846731 GGTTTAATTGGTCTTGGATAGGG - Intronic
994618770 5:102137860-102137882 AGTTTATTGAGACCAGGAAATGG + Intergenic
996744357 5:126833486-126833508 TGTTTATTTAGACCAGGACTAGG - Intronic
998525196 5:142836430-142836452 GGTCTAATTAGCCCAGGTAAAGG - Intronic
999875291 5:155798999-155799021 GATTTAATTATAACAGGAAAAGG - Intergenic
1009292267 6:61897200-61897222 GGTTTAATTGGCCTAGGGTATGG - Intronic
1010498922 6:76570178-76570200 GGATTTATTAGACTGGGATAGGG + Intergenic
1012319561 6:97825890-97825912 AGTTTAATTTGGCCAGGAAAAGG - Intergenic
1012497893 6:99854897-99854919 TGCTGAATTAGACCAGGATGTGG - Intergenic
1018813054 6:167311654-167311676 GGGTTAAAGAGACCAGGATGTGG - Intronic
1023187524 7:37547744-37547766 GGTTTATTTAGCCAAGGTTAAGG + Intergenic
1026652073 7:72224481-72224503 TGTTTAAAAAGAGCAGGATATGG + Intronic
1028885094 7:95923246-95923268 GAATTTATTTGACCAGGATAAGG + Intronic
1032799284 7:135305615-135305637 GGTTCAACTTGACCAGGCTAAGG + Intergenic
1035220822 7:157405680-157405702 GGTTTAATTGGCGCAGGATGTGG - Intronic
1040906646 8:52475917-52475939 GGGCTAATTAGACCAGTAGAGGG + Intergenic
1043247122 8:78018169-78018191 GGTTAATTTAGACCTGGATGAGG - Intergenic
1045264771 8:100609671-100609693 GGTTGGCTTAGACCAGGAAAGGG + Intronic
1057888676 9:98851509-98851531 GGGATAATTAAACCAAGATATGG + Intergenic
1187144568 X:16625892-16625914 GGTTTATATAGTACAGGATAGGG + Intronic
1188026712 X:25217671-25217693 GATTGAATTACACCATGATATGG + Intergenic
1197748600 X:129949928-129949950 GGATTAATTAGATGAGGAAAGGG - Intergenic
1198951054 X:142072897-142072919 TGTCTAATTAGAGCATGATATGG - Intergenic
1199691933 X:150315104-150315126 TGTTTTAATATACCAGGATATGG - Intergenic