ID: 1132079608

View in Genome Browser
Species Human (GRCh38)
Location 15:98852848-98852870
Sequence CAGAATAAGGGCAGGGATGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 322}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132079608_1132079617 25 Left 1132079608 15:98852848-98852870 CCGGCATCCCTGCCCTTATTCTG 0: 1
1: 0
2: 2
3: 36
4: 322
Right 1132079617 15:98852896-98852918 GAGCACAGCATACTGTTCTCAGG 0: 1
1: 0
2: 0
3: 7
4: 134
1132079608_1132079614 1 Left 1132079608 15:98852848-98852870 CCGGCATCCCTGCCCTTATTCTG 0: 1
1: 0
2: 2
3: 36
4: 322
Right 1132079614 15:98852872-98852894 CTTTCTTCTCTTCCATCTCCTGG 0: 1
1: 0
2: 6
3: 77
4: 667

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132079608 Original CRISPR CAGAATAAGGGCAGGGATGC CGG (reversed) Intronic
900864723 1:5260222-5260244 GAGAAGAGGGGCAGGGACGCTGG - Intergenic
901742304 1:11350295-11350317 CAGGAGGAGGGCTGGGATGCAGG - Intergenic
901807604 1:11748222-11748244 CAGTCTGGGGGCAGGGATGCCGG - Intronic
901975840 1:12943129-12943151 GAGAATGAGAGAAGGGATGCAGG - Intronic
901983429 1:13054236-13054258 GAGAATGAGAGAAGGGATGCAGG - Intronic
901985577 1:13073099-13073121 GAGAATGAGAGAAGGGATGCAGG + Intronic
901996232 1:13153668-13153690 GAGAATGAGAGAAGGGATGCAGG - Intergenic
901998660 1:13174682-13174704 GAGAATGAGAGAAGGGATGCAGG + Intergenic
902009334 1:13258636-13258658 GAGAATGAGAGAAGGGATGCAGG + Intronic
902030548 1:13418998-13419020 GAGAAATAGGCCAGGGATGCTGG + Intronic
903145493 1:21369397-21369419 GAGAATAAGGCCAGGCATGGTGG + Intergenic
903283586 1:22263789-22263811 CAGAACAGGGGCAGGGACACGGG + Intergenic
904262064 1:29293565-29293587 CAGAAGAATGGCATGAATGCGGG - Intronic
904408785 1:30312335-30312357 CAGGATGGGGGCAGGGCTGCTGG + Intergenic
907401467 1:54227332-54227354 CAGGATAAGGGCCAGGAGGCGGG + Intronic
907467963 1:54652022-54652044 CAGATTGAGGGTAGGGGTGCTGG + Intronic
907849978 1:58247151-58247173 CAGAATGGGGGCAAGGAGGCTGG + Intronic
908629315 1:66084939-66084961 TAGAGTTAGGGCAGGGATGGTGG + Intronic
909426016 1:75526095-75526117 CAGAATAAGGGAATGGCTGTAGG - Intronic
910439515 1:87238316-87238338 CAGCATGGGGGCAGGGAAGCTGG + Intergenic
911034278 1:93522885-93522907 CAGGATATGGGCAGGCATACAGG + Intronic
912587886 1:110783438-110783460 CAGGAAAAGGGCAGTGATGAAGG - Intergenic
914765783 1:150636537-150636559 CGGAATAAGAGAAGAGATGCAGG + Intergenic
915137590 1:153744282-153744304 CAGACTCAGGACAGGGAAGCAGG - Intronic
916604661 1:166328821-166328843 AAGAAGAAGGGGAGGGATGCTGG - Intergenic
920144284 1:203844827-203844849 CAGAAAAAGGGGAGGGAGGAGGG - Intronic
920420234 1:205828118-205828140 AAGAGTAAGGGGAGAGATGCAGG + Exonic
920983091 1:210856659-210856681 TAGCATGAGGGCAGGGATGAGGG - Intronic
921072156 1:211669878-211669900 CAGAAGAAGGGGAGGGGTGATGG - Intronic
921997600 1:221438450-221438472 CAAAATAAGGGCAGGCGTGGTGG + Intergenic
922920185 1:229295363-229295385 TAGTAATAGGGCAGGGATGCAGG + Intronic
923296442 1:232599165-232599187 CAGAATGAGGGCAGGGGTTCTGG + Intergenic
924264079 1:242263132-242263154 CAGAAAAAGGCCAGGCAGGCTGG - Intronic
1064249477 10:13695878-13695900 CAGAGGAAGGGCAGAGCTGCAGG - Intronic
1064739417 10:18416918-18416940 CAGAATTAGGGCAAGGACCCAGG + Intronic
1065139124 10:22703508-22703530 CAGAAAAAGCGCAGGGCAGCTGG + Intronic
1066720719 10:38335332-38335354 CAGAAAAAGGCCAGGCAGGCTGG + Intergenic
1067137992 10:43628788-43628810 CAAAATCAGGGCAGGGCTACAGG + Intergenic
1067552307 10:47244626-47244648 CAGGATAAGGGCAGGTCTGTAGG + Intergenic
1068975294 10:63002531-63002553 AAGAAGAGGGGTAGGGATGCCGG - Intergenic
1070493920 10:77003798-77003820 AAGGATAAGGGGAGGGATGATGG + Intronic
1070849332 10:79551000-79551022 CAGAAGAAGGTCAGGGGTGGGGG + Intergenic
1070963089 10:80512580-80512602 CAGAAAAAGGACAGGGAAGAGGG - Intronic
1071809930 10:89168363-89168385 CAGAAATAGGCCAGGCATGCTGG + Intergenic
1073159258 10:101375530-101375552 GAGAATAATGGCAGGGAGTCTGG + Intronic
1073613414 10:104967945-104967967 CAGGATAAGGCCAGGTATGGTGG - Intronic
1076228911 10:128803800-128803822 CAGAATGGGGGCAGGGGTGGGGG - Intergenic
1076550182 10:131273127-131273149 CAGGGTAATGGAAGGGATGCGGG - Intronic
1076587356 10:131558608-131558630 CAGAATGAGGCGAGTGATGCGGG - Intergenic
1076653012 10:132003086-132003108 AAGAAAAAGGCCAGGCATGCTGG + Intergenic
1077292723 11:1806034-1806056 CAGAATGAGGCCAGGCATGGTGG + Intergenic
1077445447 11:2588533-2588555 CAGAGACAGGGCAGGGCTGCTGG - Intronic
1077485910 11:2838366-2838388 CAGAGTGAGGCCAGGGATGGGGG + Intronic
1078081537 11:8207749-8207771 CAGGATAGGGACAGGGATGACGG - Intergenic
1078124868 11:8551415-8551437 CAGAATAAGGCCAGGCATGGTGG - Intronic
1080671431 11:34382892-34382914 CAGAAGAACTGCAGAGATGCTGG + Intergenic
1082263696 11:50097343-50097365 GAGAATAAGGCCAGGCATGGTGG + Intergenic
1082879586 11:58024857-58024879 CAGAGTCAGGGCAGGGAGCCAGG + Intronic
1083424681 11:62577119-62577141 CAGGACAAAGGCAGGGATTCAGG - Intronic
1084024224 11:66437922-66437944 CAGAATGAGGGCAGGAATAGAGG - Intronic
1084085478 11:66853105-66853127 CAGAATGAGGGCAGGGGTGAGGG + Intronic
1085559173 11:77454481-77454503 GAGAAGAAGGGAATGGATGCTGG - Intronic
1085758957 11:79225347-79225369 CAGAGAAAAGGCAGAGATGCAGG - Intronic
1089161792 11:116443906-116443928 CAGCATAAGAGTAGCGATGCTGG + Intergenic
1089342943 11:117772005-117772027 CAGAATGAAGGCAGGGCTCCAGG + Intronic
1089629136 11:119773011-119773033 AAGAACAAGGTCAGGGAGGCTGG - Intergenic
1090416631 11:126544817-126544839 CAGATTAAGGCCAGGAATGTCGG - Intronic
1090836651 11:130458912-130458934 CAAGATGAGGGCAGGGATGAAGG - Intronic
1091934862 12:4427168-4427190 CAGATTTAGGGCAGGGGTGGGGG - Intergenic
1092275886 12:7060728-7060750 CAGAACCAGGACAGGGAGGCTGG + Intronic
1092759921 12:11800559-11800581 CAGAGTAAAAGAAGGGATGCGGG - Intronic
1092938245 12:13383923-13383945 TAGGATAAGGCCAGGGAAGCGGG - Intronic
1093925207 12:24902772-24902794 CAGATTTCGGGCAGGGATGCGGG + Intronic
1093989538 12:25574354-25574376 CAGAATAAAGGCCTGGATGGGGG - Intronic
1094253528 12:28395042-28395064 CAGAACCAGGGCTGGGATTCAGG + Intronic
1096105247 12:48993844-48993866 CAAAATAGAGGCATGGATGCAGG - Intergenic
1097162717 12:57060179-57060201 CAGAGTAAGGACAAGGATGTTGG - Intronic
1100084533 12:90893143-90893165 CATAGTAGGGGCAGGGATACTGG - Intergenic
1100372301 12:93979564-93979586 CAGAAAAATGGAGGGGATGCTGG - Intergenic
1100445400 12:94655587-94655609 CAGAATAAGGGGTGGGATCCTGG - Intergenic
1101118108 12:101551753-101551775 AAGAAGCTGGGCAGGGATGCAGG - Intergenic
1101325056 12:103708278-103708300 CACAAAAAGGGCAGGGGTGCAGG - Intronic
1101405251 12:104422890-104422912 CAAAATAAGGGAAGTGCTGCAGG - Intergenic
1101580676 12:106038727-106038749 CAGAAGAGGGGCATGGATGCTGG - Intergenic
1102786535 12:115609587-115609609 CAGAGTGAGAGCAGGGATCCAGG + Intergenic
1104571967 12:129933661-129933683 CAGGAGAAGGTCAGGGGTGCTGG - Intergenic
1104579421 12:129999440-129999462 CAGAATAAGGCCAGGCACGGTGG - Intergenic
1104585404 12:130044593-130044615 CAGGAGAAGGTCAGGGCTGCCGG + Intergenic
1107735064 13:43390843-43390865 CCGAAAAAGGGAAGGGAGGCAGG - Intronic
1108322475 13:49302065-49302087 CAGAATGAGGGCAGAGTGGCAGG + Intergenic
1108722533 13:53146987-53147009 CTGATGAAGGGCAGGGATCCTGG + Intergenic
1109215477 13:59584746-59584768 CAGAATTAGTACAGGGATGCAGG + Intergenic
1110490332 13:76096051-76096073 AAGAAAAAGGGAAGGGAGGCAGG - Intergenic
1112487323 13:99831786-99831808 CAAAACAAGGCCAGGGATGGAGG - Intronic
1113330705 13:109324285-109324307 CACAATAAGGGCAGGGAAGAGGG + Intergenic
1117873317 14:60223101-60223123 TAGAAAATGGGCAGGAATGCAGG - Intergenic
1118817779 14:69325001-69325023 CAGGACAAGGGCAGAAATGCAGG + Intronic
1119704280 14:76774309-76774331 CATAAACAGGGCAGGGATGTCGG - Intronic
1119877754 14:78075042-78075064 CAGAGAAGGGGCAGAGATGCTGG - Intergenic
1120680829 14:87478528-87478550 CAGAATCAGAGCATGGATGTCGG + Intergenic
1126260510 15:46683850-46683872 CAGAAGAGGGGCAGGGATTTTGG + Intergenic
1128209360 15:65883832-65883854 CAGAATAAGGCCAGGGGCGGTGG - Intronic
1128715401 15:69904216-69904238 CAGAATTAGGGAAGGGCTGCAGG + Intergenic
1129659431 15:77544715-77544737 CAGATCCAGGGCAGGGGTGCTGG - Intergenic
1129751299 15:78066455-78066477 CAGCAGAAGGGCTGGGATGCTGG + Intronic
1130274403 15:82469046-82469068 CAGATGAAGAGCAGGGATGCTGG + Intergenic
1130466750 15:84196420-84196442 CAGATGAAGAGCAGGGATGCTGG + Intergenic
1130497514 15:84477116-84477138 CAGATGAAGAGCAGGGATGCTGG - Intergenic
1130589045 15:85201013-85201035 CAGATGAAGAGCAGGGATGCTGG + Intergenic
1132079608 15:98852848-98852870 CAGAATAAGGGCAGGGATGCCGG - Intronic
1133023517 16:2977338-2977360 CGTGATGAGGGCAGGGATGCAGG - Intronic
1133386060 16:5371351-5371373 CAGAGTGATGCCAGGGATGCCGG + Intergenic
1134310706 16:13072946-13072968 TAAAATAAGGCCAGGGATGGCGG - Intronic
1134871848 16:17659091-17659113 CCAAAAAAGGGCAGGAATGCAGG + Intergenic
1135115604 16:19720727-19720749 CAGAATGAGGTCAGGCATGGTGG + Intronic
1136065790 16:27757423-27757445 CAGAAGGAAGGCAGGAATGCTGG + Intronic
1137474890 16:48799124-48799146 CAGAAAGAGGACAGGGATGAGGG + Intergenic
1137650341 16:50114640-50114662 CAGGATGAGGGCAGGAAGGCGGG - Intergenic
1138135043 16:54514030-54514052 CAATGTCAGGGCAGGGATGCAGG + Intergenic
1138479176 16:57290429-57290451 CAGAAAAAGGGCAGGGAGCCAGG + Intergenic
1138983205 16:62295711-62295733 AAGAATAAGGCCAGGCATGGTGG + Intergenic
1139371740 16:66473349-66473371 CAGAAGTGGGGCAGGGAGGCCGG - Intronic
1139601062 16:67987515-67987537 CAGAATAAGGACTGGGAAGGTGG + Exonic
1140794370 16:78423170-78423192 AAAAATAAGGGCAGGCATGGCGG - Intronic
1141147280 16:81540191-81540213 CACAAAAAGGCCAGCGATGCTGG - Intronic
1141472091 16:84245823-84245845 AAGAAGAAGGGCAGAGAGGCAGG + Intergenic
1141582943 16:85012614-85012636 CAGAATAAGGCCAGGTGTGGTGG + Intergenic
1141604784 16:85146549-85146571 CAGGCTAAGAGCAAGGATGCTGG - Intergenic
1141680728 16:85542169-85542191 TAGAGTCAGGGCTGGGATGCGGG + Intergenic
1142266863 16:89067995-89068017 CAGATTAGGGGCAGGGCTGCTGG - Intergenic
1144472274 17:15555578-15555600 CAGCCTAGGGGCAGGGATGGAGG - Intronic
1144924200 17:18789116-18789138 CAGCCTAGGGGCAGGGATGGAGG + Intronic
1146186267 17:30726541-30726563 CAAAATAAGGCCAGGAATGGTGG + Intergenic
1146578044 17:34012046-34012068 CAAAATAAGGGGAGGGAGGAAGG - Intronic
1146654089 17:34625184-34625206 CAGAATGGGGGCAGGGAGGGAGG + Intronic
1147456032 17:40538673-40538695 CAGAAGAGGGGCAGGAATCCAGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149464218 17:56861874-56861896 CAGACTATGGGAAGGGATGGGGG + Exonic
1150329245 17:64281964-64281986 CAGAATAAGGGCAGGGGTGGGGG - Intergenic
1151961412 17:77407854-77407876 CAGGAAAAGAGCAGGGATCCAGG - Intronic
1152765027 17:82131963-82131985 AAAAATAAGGCCAGGCATGCTGG + Intronic
1153027494 18:684747-684769 CACAATAAGATCAGGGATGAGGG - Intronic
1153043031 18:832084-832106 AAGCACAAGGGTAGGGATGCTGG - Intergenic
1155926585 18:31662374-31662396 CAGAATAATGGCCGGGGTGGCGG - Intronic
1156089396 18:33447359-33447381 CAGGATAATGGCAGGGATGTTGG + Intergenic
1157591116 18:48836937-48836959 CCAAATGTGGGCAGGGATGCAGG - Intronic
1157757013 18:50227879-50227901 AAGAGTAAGGGAAGGGATGGAGG - Intronic
1158581429 18:58687340-58687362 CAGAATAAGGGATGTGATGTGGG + Intronic
1158782292 18:60665699-60665721 CAGAATAAGGCCAGGCACGGTGG + Intergenic
1159501573 18:69278179-69278201 CTGAACAAGGGCAGAGATCCTGG - Intergenic
1159805685 18:72956191-72956213 CAAAATTAGTGCAGGGATGTTGG - Intergenic
1159884435 18:73890888-73890910 GAGAGAAAGGGCAGGGAGGCAGG + Intergenic
1160782173 19:882716-882738 CAGAAACAGTGCAGGGCTGCTGG + Intronic
1162848266 19:13410969-13410991 CTGAATAAGGGCATAGATGCAGG - Intronic
1162972570 19:14189515-14189537 CAAAATAAGGCCAGGAATGGTGG - Intronic
1164625508 19:29724928-29724950 CAGAATAAACGCAGGGTTTCCGG - Intergenic
1164643302 19:29841995-29842017 CAGAAAAGGGGAAGGGATGCTGG + Intergenic
1165094538 19:33403044-33403066 CAGGATACGGGAAGGGCTGCTGG + Intronic
1165166134 19:33858278-33858300 CAGACTGTGGGCAGGGATGTGGG + Intergenic
1166018257 19:40000335-40000357 CAGAATAAGGGTGGGCATGGTGG + Intronic
1166552481 19:43675572-43675594 CAGAAACACGGCAGGGATGTCGG + Intergenic
1168426230 19:56241168-56241190 AAAAATAAAGGCAGGTATGCGGG - Intronic
927081328 2:19633749-19633771 CAGGAGGAGGGAAGGGATGCTGG - Intergenic
930418969 2:51125617-51125639 TAGAATAAGGTAAGGGATACGGG + Intergenic
931082340 2:58788517-58788539 CAGCATAAGGGGAAGGATACAGG + Intergenic
932255795 2:70285102-70285124 AAGTATAAGAGCAGTGATGCTGG + Intronic
933293431 2:80463099-80463121 CAGAAAAAGGTCAGAGATGGAGG - Intronic
933972334 2:87480310-87480332 CAAAAGAAGGCCAGGGCTGCTGG - Intergenic
934501776 2:94866996-94867018 GAGAATAAGGCCAGGCATGGTGG + Intergenic
935473715 2:103491673-103491695 CAGAAAATGGTCAGGGATGGAGG - Intergenic
936286785 2:111187343-111187365 CAGAGTCAGGGGAGGTATGCAGG + Intergenic
936611758 2:114008537-114008559 CAGAATCAGGGAAGGGAAGAAGG + Intergenic
937410364 2:121669711-121669733 CAGAATTTGGGCAGGGTCGCAGG + Intergenic
937413278 2:121694982-121695004 CAGAAAAAGGCCAGGGACTCTGG + Intergenic
940834066 2:158500912-158500934 CAGAGTAAAAGCAGGGAGGCTGG - Intronic
941365755 2:164609286-164609308 CAGAATTAGGGCACAGGTGCTGG - Intronic
941749008 2:169116184-169116206 AAGAAAAAGACCAGGGATGCAGG - Intergenic
941773303 2:169364907-169364929 CAGAAAAGGGGTAGGGATGGGGG + Intergenic
941831481 2:169965554-169965576 AAGTATAAGAGCAGTGATGCTGG - Intronic
944512366 2:200477197-200477219 CAGAAAAAGGGCAGGGTCCCTGG - Intronic
945868658 2:215203560-215203582 CAGGAAAAGGGCAGGGGTCCTGG - Intergenic
946174956 2:217916907-217916929 CAGAGAATGGGCAGGGAGGCCGG + Intronic
948057488 2:235019363-235019385 CAGAAGAAAGGGAGAGATGCAGG + Intronic
948362134 2:237429754-237429776 CAGAATAAAGACAGGGTTGAAGG + Intergenic
948881644 2:240860798-240860820 CAGAACAAGGACAAGGATGAGGG + Intergenic
1168762992 20:362462-362484 CAGAGCAAGGCCAGGGTTGCCGG - Intergenic
1168817030 20:745008-745030 AAGAATAAGGGAAGGTAGGCTGG + Intergenic
1169055116 20:2614316-2614338 AAGAATAAGGCCAGGTATGGTGG + Intronic
1169076982 20:2767314-2767336 AAGAATAAGGCCAGGCATGGTGG - Intergenic
1172921122 20:38483174-38483196 TAGAATAAGGCCAGGTATGGTGG - Intronic
1173413939 20:42839107-42839129 CAGAAGAAGGGCACAGGTGCTGG + Intronic
1173447704 20:43134938-43134960 CAGGTTGAGGCCAGGGATGCTGG - Intronic
1174318061 20:49718184-49718206 CAGAGTGAGGGCAGGGAGGAAGG - Intergenic
1174595544 20:51680478-51680500 AAGGATAAGGGGAGGGATGGAGG - Intronic
1174926620 20:54767313-54767335 CAGAGTGAGGGCAGGGAGGCAGG - Intergenic
1174946428 20:54991280-54991302 CAGAAAGAGGGCAGAGATGAAGG - Intergenic
1175175085 20:57106667-57106689 CAGAATAAGGGAATAGATGCTGG + Intergenic
1175238317 20:57527398-57527420 CAGAGAAAGGGCAGGAATGTGGG + Intergenic
1175254352 20:57630189-57630211 CAGAATAAGGGGTTGGGTGCTGG - Intergenic
1175516283 20:59572227-59572249 AGGAACAAGAGCAGGGATGCGGG + Intergenic
1176301606 21:5101478-5101500 CAGGGGCAGGGCAGGGATGCAGG + Intergenic
1176515851 21:7782899-7782921 TAGAATGAGGGCAAGGATGAAGG - Intergenic
1176599788 21:8781395-8781417 CAGACTAAGGCCAGGCATGGTGG - Intergenic
1177640824 21:23842694-23842716 CAGAATAAGAGAAGGTATTCAGG - Intergenic
1177885535 21:26741596-26741618 CGGAAGAAGAGCAGGGAGGCTGG + Intergenic
1178649879 21:34412911-34412933 TAGAATGAGGGCAAGGATGAAGG - Intergenic
1179855425 21:44160421-44160443 CAGGGGCAGGGCAGGGATGCAGG - Intergenic
1179953284 21:44723765-44723787 CAGAACTAGGGAAGGGAGGCGGG + Intergenic
1181456500 22:23063004-23063026 CAAAGTAACGGCAGGGATGGTGG + Intronic
1181950607 22:26550944-26550966 GGGAAAAAGGGCAGGGAGGCTGG + Intronic
1182807752 22:33089782-33089804 CAGAAAAAGGTCAGGCATGGTGG - Intergenic
1182899293 22:33884658-33884680 CAGATTAAAGGCGGGGTTGCCGG - Intronic
1183574873 22:38681818-38681840 CCGGATAAGGCCAGGGCTGCCGG + Intergenic
1183686209 22:39362677-39362699 CAGGACAAGGGCAGGAAGGCTGG + Intronic
1183979231 22:41530050-41530072 GAGATTAAGGGTAGGGCTGCTGG - Intronic
1184130053 22:42512307-42512329 CACAACAAGGCCAGGGATGGTGG + Exonic
1184140232 22:42574125-42574147 CACAACAAGGCCAGGGATGGTGG + Exonic
1184630523 22:45774634-45774656 CAAAATAAAGGCAGGGGGGCTGG + Intronic
1184724431 22:46335463-46335485 CAGAAGAAGAGCAGTGAGGCCGG + Exonic
949888288 3:8713478-8713500 AAGAATCAGGCCAGGGATACAGG + Intronic
950020788 3:9786233-9786255 CAGAATAAGAGCAAGGAGGCCGG - Intronic
950586341 3:13895201-13895223 CCGAAGAAGGGGAGGGAAGCAGG + Intergenic
951626909 3:24675380-24675402 CAGCATAAGGGCAGGAAAGTAGG - Intergenic
951976216 3:28512470-28512492 CAGAATTAGGCCAGGCATGGTGG - Intronic
954048940 3:47957004-47957026 GGGAATAAGGGCAGGGGTGAGGG + Intronic
954258040 3:49419748-49419770 CAGAACCAGGGCAGAGATGTGGG - Exonic
954839019 3:53495048-53495070 GAGAATAAGGGCAGGGACCGCGG + Exonic
956747505 3:72321337-72321359 CAGAATGAGGGCAGGAGTGAGGG - Intergenic
958819172 3:98952806-98952828 CAGAATAAGGGAAGGGTCACAGG - Intergenic
961189988 3:124951931-124951953 GAGAACATGGGCAGGGATGTGGG - Intronic
963624490 3:147653998-147654020 CAGAAAAAAAGCAGTGATGCTGG - Intergenic
964231533 3:154475937-154475959 CAGAATATGGGCACAGAGGCAGG + Intergenic
966788519 3:183642188-183642210 CTGAATCAATGCAGGGATGCAGG - Intronic
967109475 3:186280993-186281015 CAGAATAAGGGAAGGAAGGTGGG - Intronic
968057097 3:195700457-195700479 CAAAATAAGGCCAGGCATGGTGG + Intergenic
968282159 3:197485165-197485187 GAGTATCAGGGCTGGGATGCTGG - Intergenic
969405660 4:6989791-6989813 AAGAAAAAAGGCAGGGAGGCAGG - Intronic
969431138 4:7154974-7154996 CAGAATCAGGGCAGGAAAGTGGG + Intergenic
969608840 4:8216055-8216077 CAGAAGAGGGGCAGGGAGGCAGG - Intronic
970692618 4:18637113-18637135 CAGGATAAAGGCAGGAATCCTGG + Intergenic
970723242 4:19012507-19012529 AAGAATATGGGTAGGGATGGAGG + Intergenic
971261557 4:25061946-25061968 CAGAATAAGGAAATGGATGAAGG - Intergenic
971363800 4:25959863-25959885 CAGAATATGGTCAGGCATGGTGG + Intergenic
972353071 4:38255086-38255108 AAGAATAAAGGAAGGGATGGAGG + Intergenic
973724847 4:53764689-53764711 CAGAGTTTGGGCAGGGATGGAGG - Intronic
976326520 4:83777882-83777904 CAGAACAAGGGAAGGGAGGATGG + Intergenic
977603219 4:98956315-98956337 CAGAATAAGGCCAGGTGTGGTGG + Intergenic
980625174 4:135365590-135365612 CAGAATAAGGCCAGGTATGGTGG + Intergenic
981243273 4:142504351-142504373 CCAAATAATGGCAGGGATGTAGG + Intronic
982986922 4:162221574-162221596 AAGAATGAGGACACGGATGCTGG + Intergenic
983216681 4:165008425-165008447 CAGACTCAGGGCAGTGAAGCAGG - Intergenic
983424692 4:167568494-167568516 CAGGATAAGGCCAGGCATGGTGG + Intergenic
984647830 4:182238455-182238477 CAGAGTAAGGGCATAGAGGCTGG - Intronic
986065375 5:4229585-4229607 CAGAGGAAGGGCAGGGTTGGCGG - Intergenic
987046700 5:14115647-14115669 TAGAAGAACAGCAGGGATGCAGG + Intergenic
987396302 5:17427710-17427732 CACAGTGAGGGCTGGGATGCAGG - Intergenic
987811419 5:22840960-22840982 AAGAACAAGGGGAAGGATGCAGG + Intronic
987874909 5:23668559-23668581 CAGAAAAAGGCCAGGTATGGTGG - Intergenic
989187894 5:38642732-38642754 CAGAATAAGCCCTGGGAAGCAGG - Intergenic
990074080 5:51820960-51820982 CAGAAAGTGGGGAGGGATGCAGG - Intergenic
990476116 5:56163158-56163180 CAGAGTGAGGGCAAGAATGCAGG - Intronic
991927935 5:71723230-71723252 CAGAGTAAAGGCAGGGGTGAGGG - Intergenic
992388517 5:76309270-76309292 CAGAAAGAAGGCAGGGAGGCTGG + Intronic
993131191 5:83900237-83900259 CGGTATAAGTGCAGGGATGGGGG + Intergenic
994122565 5:96133389-96133411 CAGAATAATGGAAGGAGTGCTGG + Intergenic
994664999 5:102695263-102695285 CAGAATGAGGGCAAGGGTGAGGG + Intergenic
995083369 5:108079972-108079994 AAGAATTAAGGCAGGGAGGCAGG + Intronic
997621039 5:135295559-135295581 CAGAATGAGGACATGCATGCAGG - Intronic
998350818 5:141499592-141499614 CAGGATAAGGGTAGGGATATAGG - Intronic
998772523 5:145562573-145562595 ATGAATAAGGGCAGGAATGTAGG + Intronic
1000202875 5:159028890-159028912 CAGAAGAAGGCCAGTGAGGCTGG + Intronic
1001437903 5:171714917-171714939 GAGGAAAAGGGGAGGGATGCTGG - Intergenic
1001582677 5:172809599-172809621 AGGTATAAGGGAAGGGATGCGGG - Intergenic
1001722759 5:173870036-173870058 CAGAATAAGGCCAGGTGTGGTGG + Intergenic
1001760640 5:174205229-174205251 CTGCAGAGGGGCAGGGATGCTGG + Intronic
1004222713 6:13760222-13760244 CAGCTTAAGGGCAGGTATGGAGG - Intergenic
1005978847 6:30820534-30820556 GTGAATAAGGGCAAGGAAGCAGG - Intergenic
1006946397 6:37787217-37787239 CAGAAGAAAGGCAGGGAAGTGGG + Intergenic
1007421487 6:41722458-41722480 CAGAAAAGGGGCAGGGGTGTGGG + Intronic
1007765320 6:44156410-44156432 CAGAATAAGGACTGGAATGCAGG - Intergenic
1007952014 6:45880891-45880913 CAGAATAATAGCAGTGTTGCCGG + Intergenic
1008510834 6:52274188-52274210 CAGAATAAGGTTTGGGAAGCAGG - Intronic
1009921827 6:70071882-70071904 CAAAGTAAGTGGAGGGATGCTGG + Intronic
1011040135 6:83021140-83021162 CAGAAGAAGGCCAGGCATGGTGG + Intronic
1012413094 6:98982326-98982348 GTGAATAAGGTCAGGGATGGGGG - Intergenic
1013577199 6:111495680-111495702 CAGGATGAGGGCAGGAATTCAGG - Intergenic
1013658587 6:112271253-112271275 GAGAATAAGGGTAGTGATGAAGG - Intergenic
1014329300 6:120040922-120040944 TAGGCTAAGGGCAGGGATACAGG + Intergenic
1016169636 6:140995376-140995398 CATAATAATGGCAGTGATGGAGG - Intergenic
1017671336 6:156772124-156772146 CAGGGTGAGGGCAGGCATGCTGG - Intergenic
1017674021 6:156795329-156795351 GAGAATAAGGGAAGGGAGGCCGG + Intronic
1019593001 7:1844963-1844985 CAGAAGGAGGACAGGGGTGCGGG + Intronic
1019637172 7:2082150-2082172 CAGAGAAAGGGAAGGGAGGCAGG + Intronic
1019677207 7:2321172-2321194 CAGAATAAAGCCAGGGCTACAGG + Intronic
1020083874 7:5300281-5300303 CCGGAGAAGGGCAGGGGTGCAGG + Intronic
1021172231 7:17413036-17413058 CTGAGTGGGGGCAGGGATGCTGG - Intergenic
1021298577 7:18941184-18941206 AAGAATAACGGGAGGGAGGCAGG - Intronic
1021509302 7:21417891-21417913 GAGAAGAAGGGCTGGGATGCAGG - Intergenic
1021711677 7:23422065-23422087 CAGAATAGGGCCAGGCATGGTGG - Intronic
1021840562 7:24718647-24718669 CTGAAGCAGGGCAGGGTTGCAGG - Intronic
1024326702 7:48114679-48114701 GAGAAGGAGGGCAGGGATGCAGG - Intergenic
1025210401 7:57016909-57016931 CCGGAGAAGGGCAGGGGTGCAGG - Intergenic
1025661555 7:63559938-63559960 CCGGAGAAGGGCAGGGGTGCAGG + Intergenic
1025869124 7:65414499-65414521 CAAAATAAGTGCTGGGATACAGG + Intergenic
1028273592 7:88823554-88823576 CAGAATCAGGGCATAGATGGTGG + Intronic
1028379166 7:90178721-90178743 CAGAACAAGGGCTGGGAGGCAGG + Intronic
1028835515 7:95370279-95370301 CAGAATCAGGGAAGGCATGCTGG + Intronic
1028871315 7:95773450-95773472 CATCATAAGGGCAGTGATCCTGG + Intronic
1031116884 7:117678599-117678621 CAGAATCATGGCTGGGATGTTGG + Intronic
1031351495 7:120737485-120737507 CAGAAAAAGGGCTGGGATTTGGG - Intronic
1031973489 7:128079708-128079730 CAGCAGAAAGGCAGGAATGCTGG - Intronic
1033993437 7:147315764-147315786 CAGAATAAGGCCAGGTGTGGTGG - Intronic
1034558808 7:151866795-151866817 CAGAAGACGGGCAGGCAGGCAGG - Intronic
1034672082 7:152866666-152866688 GAGAAAAAGGGAAGGGAGGCCGG - Intergenic
1036561886 8:9905401-9905423 ATGAATAAGGGGGGGGATGCTGG + Intergenic
1037862921 8:22418878-22418900 CATAATAAGGCCAGGCATGGTGG + Intronic
1039897139 8:41724607-41724629 CAGAATCAGCCCTGGGATGCAGG + Intronic
1040077083 8:43247100-43247122 CAGATTTAGGGCTGGGAGGCGGG + Intergenic
1041260871 8:56019578-56019600 GAGGAGAAGGGCAGAGATGCTGG + Intergenic
1042027845 8:64443106-64443128 CAGAATAAGGGGTGGGAGACAGG + Intergenic
1042091178 8:65161402-65161424 CAGAATGAGGGCAGGGCAGCAGG + Intergenic
1044946701 8:97396294-97396316 CAGAAGATGGGGAGGGAAGCGGG - Intergenic
1047488907 8:125358043-125358065 CAGAATAAGGCCAGGCAGGGTGG + Intronic
1047619145 8:126588683-126588705 CAGAATCAGGGAAGGAATGTTGG + Intergenic
1047648642 8:126896052-126896074 AAGAATGAGGGGAGAGATGCTGG - Intergenic
1049345867 8:142138270-142138292 CAGAGGCAGGGCTGGGATGCTGG + Intergenic
1049455534 8:142684494-142684516 GAGAAGAAGGGCAAGGATGCGGG + Intergenic
1049639097 8:143706453-143706475 CCCACTGAGGGCAGGGATGCGGG + Intronic
1049652041 8:143774504-143774526 CCGAACGAGGGCAGGGATGTGGG + Intergenic
1050276713 9:4008378-4008400 CAGAATGAGGGCAGGGAAAATGG - Intronic
1052033694 9:23657001-23657023 CAGCCTAAGGGCAGGGTTGAGGG + Intergenic
1052037074 9:23694730-23694752 GAGACTGAGGGCAGGGATGTGGG - Intronic
1052338216 9:27340569-27340591 CAGAATGAGGGGTGGGCTGCGGG - Intronic
1052467176 9:28843606-28843628 CAGAGAAAGGGGAGGGATGGAGG + Intergenic
1052473080 9:28924506-28924528 AAGAATAAGGCCAGGCATGGTGG - Intergenic
1052619146 9:30883095-30883117 GAGAATATGGGCAGGAATGAAGG - Intergenic
1053441552 9:38120522-38120544 CAGAGTCAGGCCAGTGATGCTGG - Intergenic
1057829321 9:98394855-98394877 CAGAATGAGGGAAGGGATGGTGG - Intronic
1057841090 9:98486065-98486087 CAGGAGAAGGGGAGGGAAGCAGG - Intronic
1058363576 9:104179994-104180016 CAGGATCAGGGCTGAGATGCTGG + Intergenic
1058940777 9:109810880-109810902 CAGAATGAGTGCAGGTGTGCGGG + Intronic
1059953864 9:119495892-119495914 CAAAATAAGGCCAGTGAGGCTGG + Intronic
1060074637 9:120580215-120580237 CAGAGGACGGGCAGGGAAGCGGG + Intergenic
1060812418 9:126617241-126617263 CAGAGTGAGGCCAGGGGTGCAGG - Intronic
1061534923 9:131241651-131241673 CAGGCTAAGGGCAGGCATGGTGG + Intergenic
1203652182 Un_KI270751v1:136195-136217 CAGAATAAGGCCAAGCATGGTGG + Intergenic
1187267321 X:17747188-17747210 CAGAAGAAGGGCAGGGATGAGGG - Intronic
1187317130 X:18206673-18206695 CAGAAGAAGGGCGGGGATGGGGG + Intronic
1187680236 X:21760220-21760242 AAGAGGAAGGGCAGGGCTGCAGG + Intergenic
1188891616 X:35618284-35618306 GAGAAGAAGGGCAGGGAGGATGG + Intergenic
1192180141 X:68911125-68911147 CAGAGTAAGGACAGGGCTACTGG + Intergenic
1192471195 X:71400017-71400039 AAGAATAAGGCCAGGCATGGTGG - Intronic
1194221433 X:91197433-91197455 AAGAATAAGAGTAGTGATGCTGG + Intergenic
1195365574 X:104122057-104122079 AAGAATCAGGCCAGGGATGATGG - Intronic
1197732677 X:129825013-129825035 CAGAATAGGGCCAGGCATGGTGG + Intronic
1198087388 X:133293932-133293954 AAGAGTAAGGGCAGGGAGGTGGG - Intergenic
1198198197 X:134386350-134386372 CAGAAAAGGGGCAGGGGTGAGGG + Intronic
1198429842 X:136554305-136554327 AAGAATTAGGGCAGAGATGGAGG + Intronic
1199435152 X:147804672-147804694 AAGAAAAATGACAGGGATGCTGG + Intergenic
1200167710 X:154048655-154048677 CAGAGTCTAGGCAGGGATGCAGG + Intronic
1200557945 Y:4661186-4661208 AAGAATAAGAGTAGTGATGCTGG + Intergenic