ID: 1132081784

View in Genome Browser
Species Human (GRCh38)
Location 15:98872129-98872151
Sequence CATTTAGTGCAGGTTGGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 131}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132081784_1132081787 -1 Left 1132081784 15:98872129-98872151 CCATGTCCAACCTGCACTAAATG 0: 1
1: 0
2: 0
3: 8
4: 131
Right 1132081787 15:98872151-98872173 GAAGATTATTTTCGAGCGAATGG 0: 1
1: 0
2: 0
3: 7
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132081784 Original CRISPR CATTTAGTGCAGGTTGGACA TGG (reversed) Intronic
900920503 1:5667441-5667463 CACTGTGTGCAGGTTGCACAAGG - Intergenic
901658151 1:10782448-10782470 CTCTAAGAGCAGGTTGGACACGG + Intronic
904814267 1:33183198-33183220 CATTTGGTGATGGTTGGATACGG + Intergenic
911209986 1:95128842-95128864 CATTTAGTATAGGATGTACAAGG + Intronic
916644343 1:166767944-166767966 CATTTAGAGCACTGTGGACATGG + Intergenic
917890353 1:179431430-179431452 CATCTAGTCCAGGCTGGGCATGG - Intronic
918206050 1:182310271-182310293 TATTTAGTGCAGGGTGAAGAAGG - Intergenic
918600525 1:186353651-186353673 CTTATAATGCAAGTTGGACAAGG + Intronic
919554495 1:199033243-199033265 GTATTAGTGCAGGATGGACAAGG + Intergenic
920521028 1:206626485-206626507 GATTTAGTGTATGTTGCACAGGG + Intergenic
921702668 1:218285234-218285256 CATTTAGTGCCGGTAACACAAGG - Intergenic
924571193 1:245239156-245239178 CATTTAGTGGAAGATGGACATGG + Intronic
1066403803 10:35100320-35100342 CATGTAGTGCAGGTTATAAAAGG - Intergenic
1069160381 10:65084773-65084795 CATTGAGTGGAGGCTGGAAATGG + Intergenic
1069416151 10:68202576-68202598 CATTTAGTGATGGATGGAAAAGG - Intronic
1069786720 10:70992964-70992986 CATTTTGTGCTGGGTGGAGAAGG + Intergenic
1071663323 10:87528360-87528382 CATTTAAAGCAGGGTGTACAGGG - Intronic
1072070366 10:91909313-91909335 AGTTTATTGCAGGTTGGAGAAGG - Intronic
1072130519 10:92489547-92489569 CATTCAGGGCAGGTTGGTTATGG + Intronic
1073865272 10:107796238-107796260 AATTTACTGGAGGTTGGACAGGG - Intergenic
1077156468 11:1094248-1094270 CATCGAGTGCAGGTCGGTCAAGG + Intergenic
1077849099 11:6057357-6057379 GATTGAGTGCAGGTGGCACAAGG + Intergenic
1078094523 11:8288638-8288660 GATTTAGATCAGGTTGGTCAGGG + Intergenic
1078511452 11:11987332-11987354 TTTTTAGTGCATGGTGGACATGG - Intronic
1078864307 11:15282330-15282352 GAGTTTGTGCAAGTTGGACAGGG + Intergenic
1079096772 11:17516147-17516169 CATTTAGTGTTGATAGGACAAGG + Intronic
1080875356 11:36269939-36269961 CATTCACTGCAGGTTGGAGGAGG - Intergenic
1087743762 11:101918811-101918833 CATCTAGTGGAGGTTAGAAAAGG + Intronic
1091624582 12:2112360-2112382 CAGTGAGTGCAGGGAGGACAGGG + Intronic
1092011278 12:5114676-5114698 CATTACGTGCAGGTTAAACACGG + Intergenic
1092544026 12:9437596-9437618 CCTTGAGTGCTGGTTGGAGAAGG - Intergenic
1096943879 12:55382277-55382299 TATTTAATTCAGGTTGGAAAAGG + Intergenic
1101065704 12:101018021-101018043 CATTTAATGGAGGAGGGACATGG + Intronic
1107443504 13:40449304-40449326 CATTTAGTCCAGGCTGTAAATGG - Intergenic
1108546742 13:51502684-51502706 AATTTAATGAAGGTCGGACATGG - Intergenic
1110232428 13:73181044-73181066 AATTTAGTGTAGGCTGGGCATGG + Intergenic
1110322589 13:74176714-74176736 CCTTGAGTTCAGATTGGACAAGG - Intergenic
1110834913 13:80072729-80072751 GATTAGGTGCAAGTTGGACATGG - Intergenic
1112139211 13:96619830-96619852 CTTTTTGGGTAGGTTGGACAAGG + Intronic
1115215434 14:31009370-31009392 CATTTAGTGGAGAGTGGACAGGG - Intronic
1121051209 14:90820108-90820130 CAGGTAGTACAGGTTTGACAAGG + Intergenic
1124529623 15:30493707-30493729 CATTTAGTGGATGATGGTCAAGG + Intergenic
1124572225 15:30874844-30874866 CATTAATGGCAGATTGGACATGG - Intergenic
1124769032 15:32513981-32514003 CATTTAGTGGATGATGGTCAAGG - Intergenic
1126229617 15:46309728-46309750 CATTTTGTGGATGTGGGACATGG + Intergenic
1127267747 15:57375389-57375411 TATTAAGTACAGGTTGGGCAGGG + Intergenic
1128195688 15:65753177-65753199 CTTTTAGTACAGGGTGGACCTGG + Intronic
1132081784 15:98872129-98872151 CATTTAGTGCAGGTTGGACATGG - Intronic
1134684593 16:16149889-16149911 CATTGGCTGCAGGGTGGACAGGG + Exonic
1136380468 16:29892215-29892237 CAGCTAGTGCAGGTTGGGAAGGG + Intronic
1139400261 16:66675661-66675683 CATCTAGTGAAGGTGAGACATGG + Intronic
1139933417 16:70548621-70548643 CTTTTTGTGCAGGTGGGAAAGGG + Intronic
1144008768 17:11125483-11125505 CATTTAATTTAGGTTGGACCAGG + Intergenic
1149656925 17:58314893-58314915 CCTTTAGCTAAGGTTGGACAGGG + Intronic
1155278031 18:24208658-24208680 CATTCACTGCAGGTTCAACAGGG - Intronic
1156966972 18:43106135-43106157 TATTTAGTGCATTTTGAACAGGG + Intronic
1157964577 18:52193337-52193359 CATTTAGGGCAGGAAGGAGAAGG + Intergenic
1161247073 19:3259034-3259056 GATTTAGTGAAGGGTGGACAGGG + Intronic
1162176526 19:8833696-8833718 CACTAAGTGCTGGTTGGACCTGG + Intronic
1166051668 19:40264348-40264370 CTTTTAGTGAAGTTAGGACAGGG - Intronic
1166276372 19:41757081-41757103 CATTTAGTGCAGGACACACACGG + Intronic
1166281628 19:41798070-41798092 CATTTAGTGCAGGACACACACGG + Intronic
1167124969 19:47543301-47543323 CATGTTGCCCAGGTTGGACATGG + Intronic
1167287633 19:48607411-48607433 CATTTAGTGGGGGAAGGACATGG - Exonic
1167731921 19:51264691-51264713 TATTTAGAACAGGTAGGACATGG - Intronic
930599808 2:53429922-53429944 CATTTTGTCTAGGTTGGCCAAGG - Intergenic
936699620 2:114995204-114995226 CATTTGGTCCAGGATGGCCACGG - Intronic
940475414 2:154155861-154155883 CATTTATTTCAAGTTGGACTTGG - Intronic
946046238 2:216823419-216823441 CATTTGGTCCAGGCTGGGCACGG - Intergenic
1170758320 20:19224935-19224957 CATTTAGTGTAGTTAGTACATGG + Intronic
1171816201 20:29787856-29787878 CACTGTGTGCAGGTTGCACAAGG + Intergenic
1171902163 20:30868184-30868206 CACTGTGTGCAGGTTGCACAAGG - Intergenic
1173851216 20:46219534-46219556 CATTTAGTGCCGGGAGGCCAAGG - Intronic
1174976486 20:55341297-55341319 TATTTAATGCAGGTTTTACATGG + Intergenic
1177814922 21:25965628-25965650 CATTTTGTGAAGGTTGACCATGG - Intronic
1179471730 21:41614814-41614836 CACTCAGTGCAGGGTGGGCAAGG + Intergenic
1180111774 21:45660453-45660475 CATTTAATGCAATTTTGACAAGG + Intronic
1180335537 22:11574119-11574141 CACTGTGTGCAGGTTGCACAAGG - Intergenic
955786789 3:62549690-62549712 CATTTAGTGCTTGTGGGAGAAGG + Intronic
956025069 3:64974705-64974727 TCTTTTGTGCAGATTGGACAAGG - Intergenic
959819524 3:110716030-110716052 TATTTAGTGGAGGCTGGGCATGG - Intergenic
961434539 3:126907746-126907768 AAATTAGTGCAGGTTGGAAAAGG - Intronic
964679998 3:159327983-159328005 CATTTAGTTCAGGTCGCTCAGGG - Intronic
973911150 4:55581995-55582017 CATTTAGTATAGGCTGGGCATGG - Intronic
973921771 4:55693784-55693806 CATTTACTGCAGTGTGTACAGGG + Intergenic
977734358 4:100395002-100395024 CACATAGTGCATGTTGGATAGGG + Intergenic
978646346 4:110936626-110936648 CATTTAGTCCAGATTGGAGCAGG + Intergenic
979598161 4:122557082-122557104 CATGTAGTGGAGGTGGGGCACGG + Intergenic
980592645 4:134911470-134911492 CATTCAGTGAAGGTGGAACAAGG - Intergenic
980884702 4:138749555-138749577 CCTTGAGTGCAGGCTTGACATGG - Intergenic
983666258 4:170188192-170188214 AAATTGGTGCAGGTTGGCCATGG + Intergenic
983806998 4:172006335-172006357 AACTTGGTGCAGGCTGGACACGG + Intronic
984612240 4:181854494-181854516 CATTTATTGCCAGTTGGAAAGGG - Intergenic
986369745 5:7068297-7068319 CATTGAGTGCAGGGAGGCCAAGG + Intergenic
988037718 5:25850127-25850149 CATTAGTTGCAGGATGGACAGGG - Intergenic
989168901 5:38456099-38456121 CACTTAGTGCAGCTTGGATACGG - Intronic
990939825 5:61190507-61190529 TATTTATTGCAGGTTGGTAAAGG + Intergenic
991903968 5:71488996-71489018 CATTTAATACAGGCTGGGCATGG - Intronic
993428320 5:87798756-87798778 CATTTAGTGGAGGTTTGAAGTGG + Intergenic
995366047 5:111362078-111362100 CATTTAGTGAACGTTTCACAGGG + Intronic
997143241 5:131405724-131405746 CAAATAGTGTAGGCTGGACAGGG - Intergenic
997638883 5:135435549-135435571 CATCTAGGGAAGGCTGGACAGGG + Intergenic
1000452528 5:161407658-161407680 CTTTTAGTACAGGTTGGGAAAGG - Intronic
1000826845 5:166055478-166055500 TATTTAGTGCTGGCTGAACATGG + Intergenic
1002330752 5:178438915-178438937 CTTTTGGTGCAGTTGGGACAGGG - Intronic
1003469817 6:6418885-6418907 CTTTAAGTGCAGGCTGCACACGG - Intergenic
1006273298 6:32980879-32980901 CATTTACTGAAGGAGGGACATGG + Exonic
1008747405 6:54689362-54689384 AATTTAGTGTAGATTGAACATGG + Intergenic
1010706127 6:79112888-79112910 CATTTAGTGGATGTTGAAGAGGG - Intergenic
1014841775 6:126228039-126228061 AATTAAGTGCAGATTGGCCAAGG - Intergenic
1015186531 6:130422753-130422775 CATTTAATGCAAGTTGCATATGG + Intronic
1019902696 7:4035273-4035295 AATTTAGTGCTGGCTGGGCATGG - Intronic
1020394854 7:7703088-7703110 CATTCAGTGAAGGTTTGGCAAGG - Intronic
1024331463 7:48159745-48159767 CATTAACTGCAGGTTGGACCTGG + Intergenic
1025709769 7:63898596-63898618 GATTGAGTCCAAGTTGGACAGGG + Intergenic
1032406927 7:131663044-131663066 CATTTGTTGCAGGTAGGAGAGGG + Intergenic
1040452289 8:47560270-47560292 CATATAGTGCTGGTAGGCCAAGG + Intronic
1042289063 8:67148522-67148544 TATTTAGGGCAGCTTGGACTTGG - Intronic
1043075840 8:75698491-75698513 CATTGAGTGAAGGCTGGACGTGG - Intergenic
1050333786 9:4571335-4571357 CATGTGGTGCAGGATGTACAGGG - Intronic
1053681399 9:40487781-40487803 CATTTATTGCAGCCAGGACAAGG - Intergenic
1053931387 9:43116111-43116133 CATTTATTGCAGCCAGGACAAGG - Intergenic
1054282314 9:63137153-63137175 CATTTATTGCAGCCAGGACAAGG + Intergenic
1054294488 9:63323297-63323319 CATTTATTGCAGCCAGGACAAGG - Intergenic
1054392509 9:64627785-64627807 CATTTATTGCAGCCAGGACAAGG - Intergenic
1054427157 9:65132994-65133016 CATTTATTGCAGCCAGGACAAGG - Intergenic
1054503218 9:65888545-65888567 CATTTATTGCAGCCAGGACAAGG + Intronic
1054810308 9:69429041-69429063 CGTTATGTGCAGGTTGTACAGGG + Exonic
1055812036 9:80160650-80160672 GATTTAGTGGAGGGTGGAAAGGG - Intergenic
1058782250 9:108350139-108350161 CATCTTGGGCAGGTTGGGCAAGG - Intergenic
1060419447 9:123457282-123457304 CATTTAGGGCATATTTGACAAGG - Intronic
1060670722 9:125467023-125467045 AATTTAGTGAATGTTGGACACGG + Intronic
1060789472 9:126476283-126476305 CATGTGGAGCAGGTTGGCCATGG + Intronic
1203367876 Un_KI270442v1:274141-274163 CACTGTGTGCAGGTTGCACAAGG + Intergenic
1190063283 X:47224191-47224213 CATCTAGGGCAGGTTGAACTGGG - Intronic
1191157164 X:57286494-57286516 GATATAGTGTAGGTTGGCCAGGG + Intergenic
1196186025 X:112745863-112745885 CATTTTGAGCAGGATGGTCAAGG - Intergenic
1198572628 X:137973955-137973977 CATTTAGAGCAGTTTGTAGAGGG + Intergenic
1199213786 X:145244513-145244535 CATGGGCTGCAGGTTGGACAAGG - Intergenic
1200783172 Y:7235312-7235334 CCTTGAGTTCAGGTTGGAGAAGG - Intergenic