ID: 1132082896

View in Genome Browser
Species Human (GRCh38)
Location 15:98882703-98882725
Sequence TAGGGTATACAGAAGGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 197}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132082896_1132082906 18 Left 1132082896 15:98882703-98882725 CCTTGCCCCTTCTGTATACCCTA 0: 1
1: 0
2: 0
3: 13
4: 197
Right 1132082906 15:98882744-98882766 CCTTGTCTAGGCTTCCTGTTAGG 0: 1
1: 0
2: 0
3: 12
4: 135
1132082896_1132082903 6 Left 1132082896 15:98882703-98882725 CCTTGCCCCTTCTGTATACCCTA 0: 1
1: 0
2: 0
3: 13
4: 197
Right 1132082903 15:98882732-98882754 TAGGAAGTTCACCCTTGTCTAGG 0: 1
1: 0
2: 1
3: 6
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132082896 Original CRISPR TAGGGTATACAGAAGGGGCA AGG (reversed) Intronic
904031029 1:27533500-27533522 CAGGGTAGACAGAAAGGGGAGGG + Intergenic
904111172 1:28127653-28127675 TAGTGTATGGAGAAGGGGCATGG + Intergenic
907328747 1:53657881-53657903 GAGGGTGCAGAGAAGGGGCAAGG - Intronic
910051504 1:82979267-82979289 TAGGGAACACAGTAGGAGCAAGG - Intergenic
912230085 1:107783303-107783325 TAGGGAACAGAGAAGGGGCCAGG + Intronic
912273154 1:108230194-108230216 CAGGGCATACAGCAGGTGCAAGG + Intronic
912295066 1:108464128-108464150 CAGGGCATACAGCAGGTGCAAGG - Intronic
913070092 1:115290685-115290707 TAAGAGATAGAGAAGGGGCAGGG - Intronic
914998829 1:152568621-152568643 AACAGTATACAGAAGGGGGAGGG - Intronic
916748255 1:167701048-167701070 TTGGGAATACGGAAGTGGCAAGG - Intronic
917384928 1:174462012-174462034 TAAGGTATACAGAAGGTTCTTGG - Intronic
919224598 1:194679722-194679744 CATTGTAAACAGAAGGGGCAGGG + Intergenic
921259319 1:213371728-213371750 TATGTTATGCAGAAGTGGCAGGG - Intergenic
922356721 1:224783306-224783328 GAAGGAAAACAGAAGGGGCAAGG + Intergenic
923763292 1:236867986-236868008 TAGGTGATAAAGCAGGGGCAAGG + Intronic
1062779639 10:190370-190392 GAGGGTGTGCAGAAGAGGCAGGG - Intronic
1065477408 10:26155169-26155191 TAGAGTAGACAGATAGGGCAAGG + Intronic
1065609405 10:27457161-27457183 TAGTCTTTACAGAAGGAGCAGGG + Intergenic
1065683930 10:28265000-28265022 TAGGGTAGACAGACAGGACAAGG + Intronic
1067974470 10:51008441-51008463 TAGGGTTTTCAGAAAGAGCATGG - Intronic
1068064776 10:52115761-52115783 CTGGGTATACAGAAGGGTAAAGG - Intronic
1069347953 10:67492105-67492127 TAGAGTATACAGAGGGTGTAGGG + Intronic
1069694661 10:70377670-70377692 AAGGGCAGAGAGAAGGGGCATGG + Intronic
1070584067 10:77747806-77747828 TAGGGTGTCCGGAAGGGGAATGG + Intergenic
1072097885 10:92200252-92200274 TAGGGCATACAGGCCGGGCACGG + Intronic
1074092968 10:110280360-110280382 GAGGGTATACAGTTGGGGTAAGG + Intronic
1074524303 10:114250921-114250943 TGGGTTATACAGATGAGGCAGGG + Intronic
1075791054 10:125084671-125084693 CAGGGGACACAGAACGGGCAAGG - Intronic
1083826896 11:65209044-65209066 TTGGGTAGAAAGATGGGGCAGGG - Intronic
1087853447 11:103060536-103060558 TTGGGTATACACAAGGGTCCTGG + Intergenic
1088568157 11:111195131-111195153 CAGGGTATACAGGACAGGCAGGG - Intergenic
1089266617 11:117267821-117267843 TAGGTTCTACAGAAGTGCCAAGG - Intronic
1092167606 12:6352597-6352619 CAGGGTATACAGAACTGGGATGG - Intronic
1093495299 12:19749923-19749945 TAGGATGTACAGAAGGTACATGG + Intergenic
1093514585 12:19971465-19971487 TAGGGTATGCAGGCTGGGCAGGG + Intergenic
1095587804 12:43867426-43867448 AAGAGTATACAGATGGGACAAGG + Intronic
1097728290 12:63099348-63099370 GAAGGAAAACAGAAGGGGCAAGG + Intergenic
1097776689 12:63655483-63655505 TAGGAAATACATAATGGGCATGG + Intronic
1098695067 12:73542145-73542167 TAAGGTATAAAGAAGGGGTCAGG - Intergenic
1101390855 12:104298967-104298989 TTGGGTATACACAAGGGTCCTGG - Intronic
1102226429 12:111231810-111231832 TAAAGTATACAGGAGGGGCCAGG + Intronic
1105604568 13:21916202-21916224 TAGGGTCTGCAGAAGTGGAAGGG + Intergenic
1105607665 13:21940133-21940155 TTGGGGATACAGAGGGGGCATGG + Intergenic
1106366140 13:29082785-29082807 TATTGTATACAGCAGGGCCAAGG + Intronic
1106415265 13:29541007-29541029 GAGTGTGCACAGAAGGGGCAGGG + Intronic
1109966445 13:69704275-69704297 TAAGGTAAAAAGAAGGGTCAAGG - Intronic
1111714350 13:91860790-91860812 TATGGTATACAGGCCGGGCACGG - Intronic
1112837996 13:103539581-103539603 TAGGTTAGACAGAAAGGGGAGGG + Intergenic
1113795657 13:113056184-113056206 TAGTTTATGCACAAGGGGCAGGG + Intronic
1114438295 14:22726283-22726305 TGGGGAAGACAGCAGGGGCATGG + Intergenic
1116867181 14:50040343-50040365 GATGGGATAGAGAAGGGGCATGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1119567423 14:75640660-75640682 CAGCATTTACAGAAGGGGCAAGG - Intronic
1120357329 14:83451293-83451315 TAGGGTATAGTGAAAGGGCCAGG - Intergenic
1120976582 14:90254224-90254246 TAGGGTGGACAGAGGGGGCGGGG - Intergenic
1122266325 14:100548598-100548620 CAGGGTGCCCAGAAGGGGCAGGG - Intronic
1123830982 15:24136879-24136901 CAGGGTATGCAGAAGGAACATGG + Intergenic
1123836064 15:24194254-24194276 CAGGGTATGCAGAAGGAACATGG + Intergenic
1123871471 15:24578974-24578996 CAGGGCATGCAGAAGGGGCATGG + Intergenic
1125478813 15:40066098-40066120 TAGGGAATACAGGCCGGGCACGG + Intergenic
1126380631 15:48043165-48043187 TAGTGAATATAGAAGGAGCAGGG - Intergenic
1128831855 15:70776777-70776799 TAGGGGACTCAGAAGCGGCAGGG - Intergenic
1129329186 15:74818159-74818181 TTGGATTTACAGAAGGGGCCAGG - Intronic
1131857891 15:96618012-96618034 TAGGGTCTTCAGAGGGGACAGGG + Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1133312417 16:4858230-4858252 TAAGGTACAGAAAAGGGGCATGG + Intronic
1134117560 16:11560685-11560707 AAGGTTATAGAGAAGGGGAAAGG + Intronic
1134588637 16:15434474-15434496 ACGGGTACCCAGAAGGGGCAGGG - Exonic
1136025547 16:27465953-27465975 TAGGGTGTGTAGAAGGGGCCTGG - Intronic
1143411322 17:6711184-6711206 GAGGGTACACAGCACGGGCAGGG - Intronic
1144860850 17:18300865-18300887 CATGGTCTGCAGAAGGGGCAGGG + Intronic
1147440619 17:40444818-40444840 TAGGGAATAGAGAAGGGGCCAGG + Intronic
1147814908 17:43202215-43202237 TAGAGTATGCAGGAGGAGCATGG - Intronic
1147968701 17:44207913-44207935 TGGGGGAGACAGAAGCGGCAAGG + Intronic
1148340510 17:46870685-46870707 TGGGGCATACAGAGAGGGCATGG + Intronic
1153890088 18:9505357-9505379 TAGGGTGTGGAGAAGAGGCAGGG - Intronic
1154387199 18:13904862-13904884 TAAGGTATAAGGAAGGGGCCCGG - Intronic
1156930225 18:42632811-42632833 TAGGGTATACAGATGTGGCTTGG + Intergenic
1157414246 18:47488974-47488996 TAGAGTTTACAGAAGTAGCAGGG + Intergenic
1158696568 18:59709079-59709101 TAGGGTATACAAAAGGTTCTGGG + Intergenic
1160389725 18:78521087-78521109 TCGGGGATACAGAAAGGTCAAGG + Intergenic
1161747933 19:6072951-6072973 TAGGGTTTGCAGAAGGTTCAAGG + Intronic
1161965810 19:7547956-7547978 TAAAGTATACTGAAGGGGCTGGG - Intronic
1163258759 19:16173789-16173811 CAGGGTATACAGAAGGGCTATGG + Intergenic
925379686 2:3416587-3416609 GAGGGCATAGTGAAGGGGCAGGG - Intronic
926261470 2:11267669-11267691 TAGGATATACTCAAGGGGTATGG - Intronic
926261874 2:11271668-11271690 TAGGATATACTCAAGGGGTATGG + Intronic
930127365 2:47812126-47812148 TTGAGGCTACAGAAGGGGCAAGG - Intronic
932284689 2:70522278-70522300 GAGGGTGTACAGATGGGGAATGG + Intronic
932499155 2:72166768-72166790 CAGCCTATACTGAAGGGGCAGGG - Intergenic
932842413 2:75095814-75095836 AAGGGCACACAGAAGGGACAGGG - Intronic
933947466 2:87299002-87299024 AAGGAGAGACAGAAGGGGCATGG - Intergenic
936332729 2:111562565-111562587 AAGGAGAGACAGAAGGGGCATGG + Intergenic
938386404 2:130870218-130870240 CAGGGTAGGCTGAAGGGGCAAGG + Intronic
939010712 2:136842955-136842977 TACATTATTCAGAAGGGGCAAGG - Intronic
939117896 2:138081659-138081681 TGGGGTTTACAGATGGGGAAAGG + Intergenic
940856474 2:158732258-158732280 AGGGGCATTCAGAAGGGGCATGG - Intergenic
940892864 2:159051997-159052019 TAGGGCATACAGCTGGGGAATGG + Intronic
944175212 2:196821198-196821220 TAGGGTGTCCAGAGGTGGCATGG + Intergenic
946226607 2:218267217-218267239 TAGAGTGGACAGAAGGGGGAAGG - Intronic
947047358 2:226003154-226003176 AAAGGTATCCAGAGGGGGCATGG + Intergenic
948508416 2:238447032-238447054 GAGAGAATACTGAAGGGGCAAGG - Exonic
948949099 2:241237239-241237261 TAGGGGAGACAGAAAGGGCAAGG + Intronic
949024670 2:241761241-241761263 TAAAGTATACAGGAGGGGCCGGG + Intronic
1170380486 20:15754744-15754766 TAGGGTATACATAATGGCCAGGG - Intronic
1172409666 20:34711680-34711702 TGGGGGAGACAGAAGGGGCAGGG + Exonic
1172869432 20:38126606-38126628 CCGGCTATACAGCAGGGGCAGGG - Intronic
1175820360 20:61905801-61905823 AAGGGAATTCAGAAGGTGCAGGG + Intronic
1180800098 22:18627693-18627715 GAGGGTGTGCACAAGGGGCAGGG - Intergenic
1180851331 22:19023258-19023280 GAGGGTGTGCACAAGGGGCAGGG - Intergenic
1181221617 22:21367573-21367595 GAGGGTGTGCACAAGGGGCAGGG + Intergenic
1182520315 22:30881211-30881233 GGGGGTAGGCAGAAGGGGCAGGG + Intronic
1182841949 22:33398251-33398273 TTGGGGATAGAGATGGGGCATGG - Intronic
1184729694 22:46365772-46365794 TTGGGAACACAGAAGGGGTAGGG - Intronic
950056814 3:10031697-10031719 AAGGGTAGACAGAATGGGGAAGG - Intronic
950138377 3:10599170-10599192 AAGGTTATTCAGCAGGGGCAGGG - Intronic
950217525 3:11169908-11169930 TGGGGCATGGAGAAGGGGCATGG - Intronic
953135585 3:40178978-40179000 TAGGGTACACAGAAGACGCAGGG - Intronic
954574052 3:51665158-51665180 TGGGGGATACAGAGGGGGCGGGG - Exonic
954832302 3:53432426-53432448 TACAGTATACAGCAGGGACAGGG - Intergenic
955246916 3:57233704-57233726 TATAGTATAAAGAAGGGGAAAGG - Intronic
955758250 3:62249297-62249319 GAGGGCAGACAGGAGGGGCAGGG + Intronic
958832829 3:99110338-99110360 TATGGAATAAGGAAGGGGCATGG - Intergenic
959584725 3:108015422-108015444 CAGGGCATGCAGGAGGGGCATGG - Intergenic
959925421 3:111915846-111915868 TAGGGAAGAAAGTAGGGGCAGGG + Intronic
962856110 3:139346319-139346341 TATGGTATACAGGAGAGGTACGG - Intronic
963042842 3:141081991-141082013 TTGGGGATACAGGAGGGACATGG - Intronic
964427634 3:156569837-156569859 TATGGTTAACAGTAGGGGCATGG - Intergenic
965190571 3:165522666-165522688 TAGGGGATAAAGAAGTGGAATGG + Intergenic
967240207 3:187431127-187431149 TTGGGTTTACAGAGAGGGCAAGG - Intergenic
969053719 4:4388945-4388967 TAGGCTTTGCAGGAGGGGCAGGG + Intronic
973918211 4:55657764-55657786 TAGAATATGCTGAAGGGGCAGGG + Intergenic
977255020 4:94731139-94731161 TAGAGTATAAAGAAGGAGTATGG + Intergenic
979085433 4:116404287-116404309 TAGGGAATACAGAAGGAGAGAGG + Intergenic
979977477 4:127214461-127214483 TAGGGAAAAAAGGAGGGGCATGG + Intergenic
981452043 4:144909826-144909848 TAGGAAATATGGAAGGGGCAGGG + Intergenic
982033502 4:151324592-151324614 TTGGGTACACAAAAGCGGCACGG - Intronic
982149272 4:152434653-152434675 AAGGATATACAGAAGGGAGAGGG + Intronic
983534253 4:168840423-168840445 TTGTGTATAAAGAAGGGCCAAGG - Intronic
986598542 5:9448446-9448468 TGGGGTAGGCAGAAGGGGCGGGG - Intronic
987719289 5:21614234-21614256 CAGGGTATGCAGAAGAGGCATGG - Intergenic
989256233 5:39368538-39368560 AAGGCTACACAGAAGAGGCAGGG + Intronic
990779088 5:59337811-59337833 TGGGGTATTCTGAATGGGCATGG + Intronic
993266471 5:85732338-85732360 CAGTGTAAACAAAAGGGGCAGGG + Intergenic
995971982 5:117983713-117983735 TTGGAGATACAGCAGGGGCAGGG - Intergenic
996109989 5:119554077-119554099 AAGGGTATTCAGGATGGGCACGG - Intronic
996215056 5:120856195-120856217 TAGGGAAGCCAGAAGGGGGATGG - Intergenic
997865650 5:137460427-137460449 TAGGGAACACAGAAGAGCCAAGG + Intronic
1001618113 5:173058150-173058172 TAGGATATACACCAGAGGCAGGG + Intronic
1002543361 5:179921264-179921286 TAGGGTAGAAAGAAGGGCAAGGG - Intronic
1002997149 6:2297518-2297540 TAGGGTATACAGGCTGGGCTGGG + Intergenic
1003225002 6:4195837-4195859 AAGGGTCTACAGAAGGTTCATGG + Intergenic
1005373036 6:25154769-25154791 TAGGGTATGCAGGATGGGCTGGG - Intergenic
1006205583 6:32338843-32338865 TAGGGAATAAACAAGGGGAAAGG + Intronic
1007459672 6:42009048-42009070 TAAGGTATACAGAAGTGTAAGGG + Intronic
1007492345 6:42233214-42233236 TAAAGTATACAGAAGGGAAATGG - Intronic
1009571427 6:65390412-65390434 TAGGGTTTTCAGAAGGAGAAGGG + Intronic
1010774595 6:79870469-79870491 TAGTGTCTACAGCAGTGGCATGG + Intergenic
1011315921 6:86031023-86031045 TAAAGTTTACAGAAGAGGCAGGG - Intergenic
1014818866 6:125963261-125963283 TAAGGTATTCAAAAGGGGGAGGG + Intronic
1016211753 6:141544458-141544480 TGGGGAAAACAGGAGGGGCAGGG + Intergenic
1016451971 6:144192607-144192629 TAAGATAGACAGAAGGAGCAGGG - Intergenic
1018362104 6:163081327-163081349 CAGGGACTACAGCAGGGGCATGG + Intronic
1018438484 6:163785615-163785637 TAGGACATATAGAAGGGGAAAGG + Intergenic
1018885920 6:167937106-167937128 GAGTGTGTACAGAAGGTGCAGGG + Intronic
1019984587 7:4646459-4646481 TATGTTATATGGAAGGGGCAAGG + Intergenic
1020771335 7:12398880-12398902 TAGGGACTACTGAAGGGGGAAGG + Intronic
1022332618 7:29394661-29394683 TAGATTAGACAGTAGGGGCATGG - Intronic
1022361729 7:29666303-29666325 TAGGAAATACATAATGGGCACGG - Intergenic
1022592898 7:31682987-31683009 GAGGGTAAAGGGAAGGGGCATGG + Intergenic
1022692015 7:32665423-32665445 TGGGGAAGACAGATGGGGCAAGG + Intergenic
1022699661 7:32747421-32747443 TAGGAAATACATAATGGGCATGG + Intergenic
1022919684 7:34999976-34999998 TGGGGAAGACAGATGGGGCAAGG + Intronic
1023954674 7:44874853-44874875 TAAGGTATAAAGAAGGGAAAAGG - Intergenic
1024556053 7:50604495-50604517 TGGGGTCTTCAGATGGGGCAAGG - Intronic
1025986904 7:66461807-66461829 AAGGGGATAGAGAAAGGGCATGG + Intergenic
1027210174 7:76140644-76140666 AAGGGGATAGAGAAAGGGCATGG + Intergenic
1029478356 7:100798618-100798640 TAGGGGAGACAGAAGGAGCAGGG + Intergenic
1029831565 7:103265868-103265890 TAGGAAATACATAATGGGCATGG + Intergenic
1034588508 7:152118096-152118118 TAGGGTAGAGAGAAGAGGAAGGG - Intronic
1034595395 7:152185050-152185072 TAAAGTATACAGGAGGGGCCAGG - Intronic
1037627023 8:20617241-20617263 TAGAGTGTAAAGAAGAGGCATGG - Intergenic
1038726532 8:30087103-30087125 TAAAGTATACAGGAGGGGCTGGG + Intergenic
1039216934 8:35282402-35282424 AAGGGTATTAAGAAGGGTCATGG - Intronic
1042912361 8:73840671-73840693 TTTGGTATGCAAAAGGGGCAGGG - Intronic
1045540640 8:103081030-103081052 TGTGGCATGCAGAAGGGGCAGGG - Intergenic
1045603015 8:103739379-103739401 TAGGGTAGAGGGAAGGGGGAGGG + Intronic
1045665919 8:104484490-104484512 TACAGTATACAGAAGCTGCAAGG - Intergenic
1047348936 8:124054906-124054928 CAGTGTATTCCGAAGGGGCAAGG + Intronic
1053613587 9:39741009-39741031 TAAGATATACACAAGGGGGAGGG + Intergenic
1053871628 9:42498966-42498988 TAAGATATACACAAGGGGGAGGG + Intergenic
1054239927 9:62601388-62601410 TAAGATATACACAAGGGGGAGGG - Intergenic
1054554060 9:66635914-66635936 TAAGATATACACAAGGGGGAGGG - Intergenic
1058656743 9:107229218-107229240 AAGGGGATACGGAGGGGGCAGGG + Intergenic
1058836179 9:108860205-108860227 TGGGGGATACAGGAGGGTCAAGG + Intergenic
1059532485 9:115048507-115048529 TAGGTTTTCCAGAAGGGGCAGGG + Exonic
1059755350 9:117288490-117288512 TAGTGTATCCAGCAGGGTCAGGG + Intronic
1060039073 9:120284231-120284253 CAGGGTATATGGAAGGGACAGGG + Intergenic
1060235123 9:121857296-121857318 TAAGTGATACAGAGGGGGCAGGG - Intronic
1060900461 9:127253197-127253219 TAGTGTCTAAAGAAGGGACAGGG - Intronic
1061537365 9:131258434-131258456 AAGGGCAGAAAGAAGGGGCACGG + Exonic
1187330904 X:18338615-18338637 TAGGTTAGACAGGAGGGGCTGGG + Intronic
1192724294 X:73731510-73731532 TAGGGACTCCAAAAGGGGCAAGG - Intergenic
1193844447 X:86451235-86451257 TATGGTATAAGGAAGGGGCCTGG + Intronic
1196198361 X:112858439-112858461 TAGGGTAAACAGAGGGGAGAAGG + Intergenic
1197873076 X:131078475-131078497 CATGGTATACTGAAGGGGTAAGG + Intronic
1198524862 X:137490981-137491003 GGGGGGATACAGAAGAGGCAAGG - Intergenic
1198801548 X:140452773-140452795 TTGGAGATACAGAAGGAGCAGGG + Intergenic
1199342847 X:146702367-146702389 GAGGGTGTACGGAGGGGGCAAGG - Intergenic
1200833897 Y:7714123-7714145 TAGTGTATTCTGCAGGGGCAGGG - Intergenic
1201352281 Y:13057030-13057052 TATGGTATAAAGAAGGGGACCGG + Intergenic