ID: 1132082903

View in Genome Browser
Species Human (GRCh38)
Location 15:98882732-98882754
Sequence TAGGAAGTTCACCCTTGTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 99}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132082897_1132082903 1 Left 1132082897 15:98882708-98882730 CCCCTTCTGTATACCCTAGTACA 0: 1
1: 0
2: 0
3: 11
4: 103
Right 1132082903 15:98882732-98882754 TAGGAAGTTCACCCTTGTCTAGG 0: 1
1: 0
2: 1
3: 6
4: 99
1132082899_1132082903 -1 Left 1132082899 15:98882710-98882732 CCTTCTGTATACCCTAGTACATT 0: 1
1: 0
2: 0
3: 4
4: 116
Right 1132082903 15:98882732-98882754 TAGGAAGTTCACCCTTGTCTAGG 0: 1
1: 0
2: 1
3: 6
4: 99
1132082896_1132082903 6 Left 1132082896 15:98882703-98882725 CCTTGCCCCTTCTGTATACCCTA 0: 1
1: 0
2: 0
3: 13
4: 197
Right 1132082903 15:98882732-98882754 TAGGAAGTTCACCCTTGTCTAGG 0: 1
1: 0
2: 1
3: 6
4: 99
1132082898_1132082903 0 Left 1132082898 15:98882709-98882731 CCCTTCTGTATACCCTAGTACAT 0: 1
1: 0
2: 1
3: 9
4: 138
Right 1132082903 15:98882732-98882754 TAGGAAGTTCACCCTTGTCTAGG 0: 1
1: 0
2: 1
3: 6
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132082903 Original CRISPR TAGGAAGTTCACCCTTGTCT AGG Intronic
901600151 1:10417220-10417242 AATGAAGTTCAGCCTTGACTTGG + Intronic
907154599 1:52322062-52322084 TAGCAAGTTCACCTTTGACATGG + Intronic
909495533 1:76273523-76273545 TAGGAAGTTCCACCTTTTCTTGG - Intronic
909527221 1:76639190-76639212 TAAAATGTTTACCCTTGTCTTGG + Intergenic
910457958 1:87417952-87417974 TAGGAAGTAAACTCTTTTCTGGG + Intergenic
914315220 1:146504427-146504449 TAGGAAGTAAACTCTTCTCTGGG + Intergenic
914499135 1:148228949-148228971 TAGGAAGTAAACTCTTCTCTGGG - Intergenic
918176443 1:182050406-182050428 TAGGAATTTCTCCCCTTTCTAGG + Intergenic
921571911 1:216789907-216789929 TGGGAAGTGCAGCCTTGCCTTGG - Intronic
1065416383 10:25491908-25491930 TATGAAGAACATCCTTGTCTTGG + Intronic
1070348559 10:75569325-75569347 TAGCCACTTCTCCCTTGTCTAGG - Intronic
1079097805 11:17522242-17522264 GATGAAGCTCACCCTTGTCCAGG - Intronic
1081203104 11:40242034-40242056 GAGGAAATGCATCCTTGTCTGGG - Intronic
1082933437 11:58632628-58632650 TAGGAAGTTCATTCCTGCCTTGG - Intergenic
1086162873 11:83743085-83743107 TAAGAAGATTACCCTAGTCTTGG - Intronic
1091171191 11:133521079-133521101 TCGGAAGGCGACCCTTGTCTGGG - Intronic
1091454864 12:599471-599493 TAGGACACTCACCCTTTTCTTGG - Intronic
1092325493 12:7527397-7527419 TGGGGAAATCACCCTTGTCTGGG + Intergenic
1102474742 12:113181196-113181218 TAGTAAGTTCTCCTTTGGCTGGG + Intronic
1103376506 12:120460434-120460456 TAGGAAGTTAGCCCTCTTCTGGG - Exonic
1104613484 12:130249723-130249745 GAATAAGCTCACCCTTGTCTGGG + Intergenic
1114355273 14:21900791-21900813 TATGAAATTCACCCTTGTGCAGG + Intergenic
1116532391 14:45988645-45988667 TAGGAAGCCCACTCCTGTCTTGG - Intergenic
1120500120 14:85286738-85286760 TAAGAAGTTCTTCCTGGTCTGGG + Intergenic
1121634724 14:95446184-95446206 TAGGAAGCTCACCTTTGTGCAGG + Intronic
1127370591 15:58335114-58335136 TAGCAAAATCAACCTTGTCTTGG + Intronic
1127983890 15:64053364-64053386 TATGAAGTTCACTTTTTTCTTGG - Intronic
1128627662 15:69227038-69227060 TAGAAAGCTCACTCTTGGCTGGG - Intronic
1130319962 15:82833366-82833388 AAGAAAGTTCACCCTGATCTTGG + Exonic
1130676028 15:85952849-85952871 CAGGAAGTAAACTCTTGTCTAGG - Intergenic
1131105265 15:89729522-89729544 TGGGAAACTCACCCTTCTCTTGG + Intronic
1132082903 15:98882732-98882754 TAGGAAGTTCACCCTTGTCTAGG + Intronic
1132926670 16:2433341-2433363 CAGGAAGGTGACTCTTGTCTGGG - Intronic
1137821193 16:51447655-51447677 TGGGAAGATCACCTTTGCCTAGG + Intergenic
1138388351 16:56651925-56651947 TAGGAACTCCAGGCTTGTCTTGG + Exonic
1138995548 16:62448185-62448207 TAAGATTTTCACCCTTGTTTTGG - Intergenic
1139219854 16:65170147-65170169 TGGTATGATCACCCTTGTCTTGG - Intergenic
1140534935 16:75701160-75701182 TAGGTAGATGACCCTTGTATGGG + Intronic
1141212091 16:81990865-81990887 TAAAAAGTTCACCCTTCTTTGGG + Exonic
1146467075 17:33094700-33094722 TTGGAAGTTCACCCTTATTTTGG + Intronic
1146498113 17:33341064-33341086 AAGGAAATTCATCCTTGTTTTGG - Intronic
1148524037 17:48312659-48312681 ACAGAAATTCACCCTTGTCTTGG - Intronic
1152739814 17:82013926-82013948 GAGGAAGGTCACCCTGGGCTAGG + Intronic
1155699594 18:28727359-28727381 TAAGAAGGTCACCCTCGGCTGGG + Intergenic
1158322428 18:56278307-56278329 GAGGAAATTCACACTTGTGTGGG - Intergenic
1160272348 18:77398451-77398473 TCTTAAATTCACCCTTGTCTAGG + Intergenic
1163270451 19:16249970-16249992 TTTGAGGTTCACCCTTGTCACGG + Intergenic
1163887382 19:19978591-19978613 TAGGAAGTTCACGCATGTCTAGG + Intergenic
1163950756 19:20582955-20582977 TAGCAAGTTCATGCATGTCTAGG + Intronic
1168497903 19:56869539-56869561 TAGAAAGGTCACCCTTGCCTAGG - Intergenic
926575235 2:14572871-14572893 TTGGAATTTCACCCTACTCTAGG + Intergenic
932235432 2:70117076-70117098 AAGTAATGTCACCCTTGTCTTGG + Intergenic
938464992 2:131519552-131519574 TAGGCAGTTCACACTCGCCTTGG + Intergenic
941788579 2:169525345-169525367 TAGGCAGTTCAGCATTCTCTGGG - Intronic
942204607 2:173607733-173607755 TAGGAAATAAAACCTTGTCTTGG - Intergenic
948042236 2:234911701-234911723 CAGGAAGTTAACACTGGTCTGGG + Intergenic
948578391 2:238968578-238968600 TAGGAACTTCCCCATTGTCAGGG - Intergenic
1169493675 20:6092629-6092651 AAGGAAGTTCATCCTTGCATGGG - Intronic
1173873173 20:46354272-46354294 TAGGAGGTTCAGCCATGTCCAGG - Intronic
1174092948 20:48063863-48063885 TAGGAAGTTCAGTCTTTTCATGG - Intergenic
1178301407 21:31456392-31456414 GAGGAAGCTCACCCTTGCCAGGG - Intronic
1182457279 22:30460020-30460042 TAAGGAGCTCACCCCTGTCTAGG - Exonic
955303254 3:57804650-57804672 TAGGAACATCACCTGTGTCTGGG + Intronic
955587016 3:60490216-60490238 TTAGATGATCACCCTTGTCTTGG - Intronic
955823149 3:62917782-62917804 TTAGATGTTCACCCTTATCTAGG + Intergenic
956100454 3:65762528-65762550 TGAGTAGTTCACCCTTTTCTTGG - Intronic
958894216 3:99812320-99812342 TCAGCAGTGCACCCTTGTCTTGG + Intergenic
962340311 3:134576763-134576785 CAGGAAGTTGACCCTGGCCTCGG + Intergenic
966203040 3:177377348-177377370 TAGGAAGTCCAACCCTGTTTGGG - Intergenic
966436781 3:179894625-179894647 TAGTAAGTACAGCCTTGTTTGGG - Intronic
973174289 4:47185310-47185332 AAGGAAGGTCACCTTTTTCTGGG - Intronic
973286971 4:48429653-48429675 TGAGAAGTTCACCCTTGTATGGG - Intergenic
976731165 4:88263529-88263551 TAGGAAGATCACCTGGGTCTGGG - Intronic
983856413 4:172651725-172651747 TACGATTTTCAGCCTTGTCTGGG - Intronic
985973780 5:3398586-3398608 GAGGAAGCTCACCCTTGGCCAGG + Intergenic
988501205 5:31785289-31785311 TAGGAAGTTCACCAAGGTCAGGG + Intronic
989489332 5:42032319-42032341 TAGGGAGTTCCCCCAGGTCTTGG + Intergenic
992331508 5:75721599-75721621 TATGGAGTTCCCCCATGTCTTGG + Intergenic
995045457 5:107641564-107641586 TAGACAGTTCACTTTTGTCTAGG + Intronic
996047965 5:118897547-118897569 TAGAAGGTTGACCTTTGTCTGGG - Intronic
998546582 5:143033445-143033467 TAGGAAGTGCATCCTTTTCTAGG - Intronic
1006692080 6:35897447-35897469 TAGGAAGTAGACCTATGTCTAGG + Intronic
1010532545 6:76986422-76986444 TAGTCAGTTCATCCTTTTCTTGG - Intergenic
1011985404 6:93437323-93437345 AAGGAACTTCAACCTTGTCATGG - Intergenic
1015766474 6:136722982-136723004 TAGAAAGTTTACACTTGGCTGGG - Intronic
1015889412 6:137954829-137954851 TGCCAAGTTCACCCTTGTTTGGG + Intergenic
1016183063 6:141170915-141170937 TATGAAATTCACTCTTGTCGGGG - Intergenic
1020522138 7:9204589-9204611 TAGTAACTTTACCCTTGTTTTGG - Intergenic
1030077927 7:105752470-105752492 AATGTAGTTCACCCTAGTCTAGG + Intronic
1030110269 7:106020918-106020940 TGGGGGGTTCACCCTTTTCTTGG - Intronic
1031110408 7:117601185-117601207 TAGAATGTACACCCTTATCTAGG + Intronic
1032296570 7:130644386-130644408 TAGAAAGTTAGCCCTTTTCTAGG + Intronic
1035411179 7:158643641-158643663 TAGGAAATTCACCTTTGCCAGGG - Intronic
1035742951 8:1943024-1943046 CATGAAGTTCACCCTTCTATAGG - Intronic
1036132438 8:6128403-6128425 TAGGAAGTGCACCCCTGGCAGGG + Intergenic
1037111686 8:15169918-15169940 TACGTAGTTCACTCTTTTCTAGG - Intronic
1047864936 8:129012775-129012797 CAAGAAGTTCACCCTCTTCTAGG - Intergenic
1048287695 8:133154553-133154575 TAGGCAGATCACCCATGGCTGGG + Intergenic
1053548135 9:39045145-39045167 TAGCATGTTCACCATTGACTTGG - Intergenic
1053812255 9:41865185-41865207 TAGCATGTTCACCATTGACTTGG - Intergenic
1054618340 9:67322254-67322276 TAGCATGTTCACCATTGACTTGG + Intergenic
1057720229 9:97526429-97526451 TAGGATGAAGACCCTTGTCTAGG - Intronic
1059876009 9:118635726-118635748 TAGGAAGTTTACTCTTTGCTGGG + Intergenic
1060248659 9:121967838-121967860 TTCGAAGTTCACCCTTGTTGTGG - Intronic
1061334284 9:129920891-129920913 TAGCAAAAACACCCTTGTCTTGG + Intronic
1196086571 X:111689891-111689913 TAGGAATTTCACACTTAACTGGG + Intronic
1199921484 X:152409251-152409273 CAGGAGGTTCACTCTTGTCTAGG + Intronic