ID: 1132082906

View in Genome Browser
Species Human (GRCh38)
Location 15:98882744-98882766
Sequence CCTTGTCTAGGCTTCCTGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 135}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132082902_1132082906 -1 Left 1132082902 15:98882722-98882744 CCTAGTACATTAGGAAGTTCACC 0: 1
1: 0
2: 0
3: 8
4: 103
Right 1132082906 15:98882744-98882766 CCTTGTCTAGGCTTCCTGTTAGG 0: 1
1: 0
2: 0
3: 12
4: 135
1132082897_1132082906 13 Left 1132082897 15:98882708-98882730 CCCCTTCTGTATACCCTAGTACA 0: 1
1: 0
2: 0
3: 11
4: 103
Right 1132082906 15:98882744-98882766 CCTTGTCTAGGCTTCCTGTTAGG 0: 1
1: 0
2: 0
3: 12
4: 135
1132082899_1132082906 11 Left 1132082899 15:98882710-98882732 CCTTCTGTATACCCTAGTACATT 0: 1
1: 0
2: 0
3: 4
4: 116
Right 1132082906 15:98882744-98882766 CCTTGTCTAGGCTTCCTGTTAGG 0: 1
1: 0
2: 0
3: 12
4: 135
1132082901_1132082906 0 Left 1132082901 15:98882721-98882743 CCCTAGTACATTAGGAAGTTCAC 0: 1
1: 0
2: 0
3: 6
4: 83
Right 1132082906 15:98882744-98882766 CCTTGTCTAGGCTTCCTGTTAGG 0: 1
1: 0
2: 0
3: 12
4: 135
1132082896_1132082906 18 Left 1132082896 15:98882703-98882725 CCTTGCCCCTTCTGTATACCCTA 0: 1
1: 0
2: 0
3: 13
4: 197
Right 1132082906 15:98882744-98882766 CCTTGTCTAGGCTTCCTGTTAGG 0: 1
1: 0
2: 0
3: 12
4: 135
1132082898_1132082906 12 Left 1132082898 15:98882709-98882731 CCCTTCTGTATACCCTAGTACAT 0: 1
1: 0
2: 1
3: 9
4: 138
Right 1132082906 15:98882744-98882766 CCTTGTCTAGGCTTCCTGTTAGG 0: 1
1: 0
2: 0
3: 12
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132082906 Original CRISPR CCTTGTCTAGGCTTCCTGTT AGG Intronic
908692903 1:66802833-66802855 CCTTGTCTGTGATTCCTGGTTGG + Intergenic
910241018 1:85086393-85086415 CATTGTCTAGGTTTCTTCTTTGG + Intronic
911987799 1:104652151-104652173 CCTTGATTGTGCTTCCTGTTTGG + Intergenic
912121192 1:106473833-106473855 CCTTGTCTAGCCATCCAGTGGGG - Intergenic
915290702 1:154881260-154881282 CCTTCTCTAGCCCTCCTGGTGGG - Intergenic
917370640 1:174289986-174290008 CATTGGCTAGGCTCCCTGGTTGG + Intronic
924583924 1:245345392-245345414 CCGAGTCTCAGCTTCCTGTTGGG - Intronic
1066324417 10:34342558-34342580 CCTTTTCTAGGCTTTGTTTTTGG - Intronic
1069575364 10:69523571-69523593 CCTTGGCTTGGCTTCCTATCGGG - Intergenic
1070131111 10:73655991-73656013 CCCCGTCTGGGCTTCCTGTCCGG + Exonic
1071436612 10:85653525-85653547 CCTTTCCTAGGCTTCCTGGAAGG - Intronic
1072372303 10:94776010-94776032 ACTTGTCTAGGGTTTCTTTTAGG + Intronic
1072382314 10:94887366-94887388 CCTTGCCTAGTTTTGCTGTTAGG + Intergenic
1079141914 11:17816698-17816720 CCTTGTCTTGGTATCCTGGTTGG + Intronic
1081408911 11:42732492-42732514 CCTATTCTGGGCTTACTGTTTGG + Intergenic
1083183692 11:61005141-61005163 CCTATTCTAGGTTTCCTGGTGGG - Intronic
1083605625 11:63976895-63976917 CCTTCTCTGGTCTTCCTTTTTGG + Intronic
1086039471 11:82458383-82458405 CCTGGTCTCTGCTTGCTGTTTGG - Intergenic
1086192964 11:84102398-84102420 CCTTTTTGAGTCTTCCTGTTAGG - Intronic
1089861354 11:121592632-121592654 CATTGTGTGGACTTCCTGTTTGG + Intronic
1091452106 12:578994-579016 CCGTGTTTAGGTTTCCTGTCTGG - Intronic
1094067271 12:26374675-26374697 CCTTTACTAGGATTCCTGTGTGG - Intronic
1095567283 12:43640142-43640164 ACTTGTCTCATCTTCCTGTTTGG - Intergenic
1096988768 12:55781219-55781241 CTTTGTCTCAGCTTCCTCTTTGG + Intronic
1097358809 12:58633124-58633146 CATTGTCCAGGATTTCTGTTTGG - Intronic
1102220723 12:111192582-111192604 CCTTTCCTAGGGTTCCTGGTGGG - Intronic
1104509237 12:129360902-129360924 CCTTGTGTAGGCTCACTGCTGGG + Intronic
1104650163 12:130525567-130525589 CCTTGACTGGGCTTCCTGGAGGG - Intronic
1106597690 13:31161195-31161217 CCTTGTGCGGGCTTCCTATTGGG - Intronic
1107447779 13:40483738-40483760 CCTTGTCCAGGCTTCTTGCCAGG - Intergenic
1107519079 13:41161293-41161315 CCTTGGCTCAGCTCCCTGTTGGG + Intergenic
1111430340 13:88141743-88141765 CAATGTCTAAGCTTCTTGTTGGG + Intergenic
1113457198 13:110457333-110457355 GTCTCTCTAGGCTTCCTGTTTGG + Exonic
1115454207 14:33582514-33582536 CCATGTTTATGCTTCCAGTTTGG + Intronic
1119432817 14:74579367-74579389 CCTTGACTAACTTTCCTGTTGGG - Intronic
1202865104 14_GL000225v1_random:111964-111986 TCTTGTCTAGGCTTTGGGTTTGG - Intergenic
1202867197 14_GL000225v1_random:129095-129117 TCTTGTCTAGGCTCTGTGTTTGG + Intergenic
1132082906 15:98882744-98882766 CCTTGTCTAGGCTTCCTGTTAGG + Intronic
1132130420 15:99272350-99272372 TCTTGTCAAGGCTTCCTCTTTGG + Intronic
1134505367 16:14801577-14801599 CCTTGTCTACTCTTCCTGCAGGG + Intronic
1134575211 16:15327333-15327355 CCTTGTCTACTCTTCCTGCAGGG - Intergenic
1134727235 16:16429159-16429181 CCTTGTCTACTCTTCCTGCAGGG + Intergenic
1134940202 16:18282696-18282718 CCTTGTCTACTCTTCCTGCAGGG - Intergenic
1135002422 16:18788062-18788084 CCTTGTTTAGCCTGCCTGTGAGG + Exonic
1137630690 16:49941707-49941729 CCTTGTCAGGTCTTCCTGCTTGG - Intergenic
1138927103 16:61605668-61605690 CCTTGTCTTGATTTCCTTTTTGG + Intergenic
1139108322 16:63856440-63856462 CCTAGTCAGGGCTACCTGTTGGG - Intergenic
1141913780 16:87078799-87078821 CATTGCCTTGGCTTTCTGTTGGG - Intergenic
1141938043 16:87255033-87255055 CCTTTTCTCGGCTTCTTGTATGG - Intronic
1142176172 16:88646475-88646497 TCTTGCCTGGGCTTCCTGGTAGG - Intronic
1144019973 17:11232217-11232239 CCTTTCCTAGGCTTCCTATTTGG + Intergenic
1147966626 17:44197682-44197704 CCTGGTCGAGGATTCTTGTTTGG - Exonic
1156066587 18:33149074-33149096 AATTGTGTAGGCCTCCTGTTGGG + Intronic
1156244359 18:35283757-35283779 CCTGGTCTGGGCTTCCTGAAGGG + Intronic
1156989352 18:43388514-43388536 CCTTTTCTTGGCTTCCCGCTTGG - Intergenic
1163199202 19:15750986-15751008 CTTTGTCTAGGTTTGCTATTAGG - Intergenic
1164399893 19:27895245-27895267 CCTTCTCTAGGTTTCCTTCTTGG + Intergenic
1165341290 19:35214110-35214132 TCTTGCCCAGGCTTCCTGTCAGG + Intergenic
1165734182 19:38165321-38165343 CCTTCTCTGGACTTCATGTTAGG - Intronic
926020604 2:9491758-9491780 CCAGGACTAGGCTTCCTGTCTGG + Intronic
928053133 2:28022193-28022215 CCCTGTCTAGGCTGCCTGACAGG - Intronic
928977691 2:37105791-37105813 CCTTGTCCAGACTTCCTGGGTGG + Exonic
932099984 2:68889848-68889870 GCTTGTCAAGTCTTCCTCTTTGG - Intergenic
932129630 2:69176116-69176138 CCTTCTCTAGGACTTCTGTTTGG - Intronic
937680537 2:124639962-124639984 CCTTGTGTTGCATTCCTGTTGGG - Intronic
938868573 2:135450745-135450767 TCTTCTCTAGGCTTACTCTTTGG - Intronic
940589425 2:155702351-155702373 TATTGTCTATGCTTCCTTTTGGG - Intergenic
943374512 2:187058641-187058663 CCATTTCAAGGGTTCCTGTTTGG - Intergenic
1169006444 20:2211136-2211158 CTTTGTCTAGCCTTCCAATTTGG + Intergenic
1170753211 20:19171173-19171195 CCTTGTCATGGCTTCCTTATGGG + Intergenic
1174190657 20:48738216-48738238 CTGTCTCTAGGCTTCCTGTGGGG - Intronic
1174722139 20:52824284-52824306 CCTGGCCCAGTCTTCCTGTTTGG - Intergenic
1177122978 21:17161421-17161443 CCTGATCTAGGCTGCCTTTTTGG + Intergenic
1177370548 21:20197776-20197798 CCTTGTCTAGCCTTCATCTTAGG - Intergenic
1178681251 21:34673849-34673871 CCTTTTCTAGGCTCCTTTTTTGG + Intronic
1180093418 21:45543573-45543595 CCCTGTGTTGGCTTCCTGGTGGG - Intronic
1182780082 22:32860623-32860645 CCTTGTCCCTGCTTCATGTTTGG + Exonic
1182912556 22:33997669-33997691 CCTGGTCTTGGCTTTCTGCTTGG + Intergenic
1183363645 22:37395914-37395936 CCTTCTTCTGGCTTCCTGTTGGG - Intronic
1184432883 22:44451921-44451943 CCTTGGCTTGGCTTCCTGCTTGG - Intergenic
1184544760 22:45159887-45159909 AGTTCTGTAGGCTTCCTGTTGGG + Intergenic
950809343 3:15636368-15636390 CTTTGTGAAGGCTTCCTGGTTGG + Intronic
950842261 3:15978862-15978884 CCCTTTCAAGGCTTCATGTTTGG + Intergenic
951273133 3:20652239-20652261 CCTTGTCTTGGCCTCATGTCAGG + Intergenic
951683814 3:25322978-25323000 GTTTGTCTAGGCTTCATGTGGGG + Intronic
954306984 3:49732685-49732707 CTTTGTCTAGGGTCCCTCTTCGG - Intronic
956310983 3:67880157-67880179 CCTTGTCTAGGCTTCAGAGTAGG + Intergenic
956343283 3:68249805-68249827 CCTTGTCAGGGCTTCATATTGGG - Intronic
960229322 3:115206625-115206647 CCTTTTCTTGGCTTCCTTCTAGG + Intergenic
960542468 3:118876684-118876706 CCTTGTCTAGTCCTTATGTTTGG - Intergenic
962276340 3:134017567-134017589 CCCTGTGCAGGCTTCCTGATGGG + Intronic
962446609 3:135471471-135471493 CCTTTTCCAGGCTTGCTTTTAGG - Intergenic
965309823 3:167115067-167115089 CCAGGTCTAGGCTTCCTGAAGGG + Intergenic
966051965 3:175628974-175628996 ACTGGGATAGGCTTCCTGTTAGG - Intronic
967753379 3:193140595-193140617 TGTTGGCTAGGTTTCCTGTTAGG + Intergenic
968782323 4:2592596-2592618 CCTTGCCCAGGCTTCCTGCCTGG + Intronic
968984825 4:3869416-3869438 CCTTGGCGAGGCTCCCTCTTGGG + Intergenic
969300977 4:6296742-6296764 CCTTGCATATGCGTCCTGTTCGG + Intronic
970875990 4:20870653-20870675 CCTTTTATACTCTTCCTGTTTGG + Intronic
974699145 4:65416596-65416618 CCTTGTATATGTTTCCTTTTTGG - Intronic
978102266 4:104856559-104856581 TCTTCTCTAGACTTCTTGTTAGG + Intergenic
986174044 5:5336938-5336960 ACTTGTCTTGGCTTCCTGAATGG - Intergenic
988331953 5:29852752-29852774 CCATCTCCATGCTTCCTGTTTGG - Intergenic
988781027 5:34521950-34521972 CCTTGCCTTGGTTTCTTGTTAGG - Intergenic
991352658 5:65734585-65734607 GATTGTCTATGCTTCCTGTTTGG + Intronic
993236758 5:85320710-85320732 CCTTGTCTGGGCATGCTGATTGG - Intergenic
996374955 5:122794711-122794733 CCTTTTCTAGTCATCCTTTTTGG - Intronic
1000116912 5:158162088-158162110 CTTCGTTTGGGCTTCCTGTTTGG + Intergenic
1000466568 5:161585934-161585956 CCTGGTTTTGGCTTCCTGTTAGG - Intronic
1001023536 5:168204364-168204386 CTTTGTGTAGGATTCCTGTGGGG - Exonic
1001541915 5:172545535-172545557 CCTTGTCTGGGCTTCTTGGTGGG + Intergenic
1002791948 6:443546-443568 GCTCGTCTTGGCTTCTTGTTTGG - Intergenic
1003149759 6:3538582-3538604 CCTTGTCTGTCATTCCTGTTGGG - Intergenic
1004713084 6:18191098-18191120 GCTTGTCTAGGCTTACTTTTTGG + Intronic
1008847047 6:55979762-55979784 CTTTGTCAATGCTTCCTTTTTGG + Intergenic
1010801508 6:80181515-80181537 TCTTGTCTAGGCTTCCTCATAGG + Intronic
1014490444 6:122055436-122055458 CCATATTTAGGCTGCCTGTTTGG + Intergenic
1019502513 7:1371435-1371457 CCTTGTCTTGGCTACATGATGGG + Intergenic
1021283972 7:18756474-18756496 CCTTATTCAGGTTTCCTGTTTGG + Intronic
1021957306 7:25838968-25838990 CCTTGGCCAAGCTTCCTGATGGG - Intergenic
1022878848 7:34564981-34565003 CTTTGTAAAGGCTTCTTGTTTGG - Intergenic
1024688689 7:51776141-51776163 CCTTATCTCAGCTTCCTGCTTGG - Intergenic
1032195787 7:129787566-129787588 CCATGCCTGGGCTTCCTCTTGGG + Intergenic
1034959499 7:155356128-155356150 TGTTGTCTAAGCTGCCTGTTAGG + Intergenic
1035434457 7:158849110-158849132 CCTTGGCTCAGCTCCCTGTTGGG + Intergenic
1038545453 8:28422818-28422840 GCTCGGCTTGGCTTCCTGTTTGG + Intronic
1038910857 8:31962640-31962662 CCTTGTCTAGGGAACCAGTTCGG + Intronic
1040885707 8:52261595-52261617 ACTTCTCTATGCTTCCAGTTTGG + Intronic
1041457045 8:58072234-58072256 CATTGTCTAGAGTTCCTTTTGGG + Intronic
1042166901 8:65954581-65954603 CCTTGTCTCTTCTTCCTGTGAGG + Intergenic
1042284496 8:67093128-67093150 GTTTGTCTAGGATTGCTGTTGGG + Intronic
1042998109 8:74723386-74723408 CCTTGTATAGGCTGCCTAATAGG + Intronic
1050360521 9:4826403-4826425 CCTTTTCTTGGCATCATGTTTGG + Intronic
1052313979 9:27097438-27097460 CCTAGTAAAGGCTTTCTGTTGGG - Intergenic
1052643465 9:31200486-31200508 GGTTGTCTAGGCTACCTGCTTGG - Intergenic
1055408762 9:76004326-76004348 CCTTTTCACGGCTTCCTGTCAGG + Intronic
1055771809 9:79724916-79724938 CCTTGACTGGGCTTTCTGTTTGG + Intronic
1057530261 9:95838753-95838775 CATTAACTAGGCTTTCTGTTAGG + Intergenic
1057824273 9:98360156-98360178 CCAAGCCTAGGCTTTCTGTTTGG + Intronic
1059789920 9:117630599-117630621 TCTTGTCTAGGCTTTCTGCCTGG + Intergenic
1062191259 9:135249050-135249072 CCTTGTCGAGCCTTCCTGGGTGG + Intergenic
1062518055 9:136945867-136945889 CCTGGACTAGGATTCCTGGTTGG + Intronic
1203739222 Un_GL000216v2:164061-164083 TCTTGTCTAGGCTTTGGGTTTGG + Intergenic
1191902813 X:66056489-66056511 CCTAGTCTAGAATTCTTGTTCGG - Intergenic
1194278590 X:91918257-91918279 CCTAGGCTAAGCTTCCTTTTTGG + Intronic
1195341362 X:103909627-103909649 CTTTATCTAGGTTTCCTGTTAGG - Intergenic
1201124796 Y:10902956-10902978 CCTTTTCTAGGCTCTCTGTATGG + Intergenic
1201395577 Y:13544279-13544301 CCTGGGCTAGGCTTCCTGATTGG - Intergenic