ID: 1132083201

View in Genome Browser
Species Human (GRCh38)
Location 15:98884879-98884901
Sequence CTGGATTAAAAGGCTGTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 161}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132083196_1132083201 6 Left 1132083196 15:98884850-98884872 CCTCTTAAGAGTAGTCCAAACTC 0: 1
1: 0
2: 1
3: 6
4: 73
Right 1132083201 15:98884879-98884901 CTGGATTAAAAGGCTGTTCCAGG 0: 1
1: 0
2: 1
3: 11
4: 161
1132083194_1132083201 30 Left 1132083194 15:98884826-98884848 CCTCCTGCTTAAAATAGTATTTT 0: 1
1: 0
2: 2
3: 32
4: 370
Right 1132083201 15:98884879-98884901 CTGGATTAAAAGGCTGTTCCAGG 0: 1
1: 0
2: 1
3: 11
4: 161
1132083195_1132083201 27 Left 1132083195 15:98884829-98884851 CCTGCTTAAAATAGTATTTTTCC 0: 1
1: 0
2: 0
3: 25
4: 345
Right 1132083201 15:98884879-98884901 CTGGATTAAAAGGCTGTTCCAGG 0: 1
1: 0
2: 1
3: 11
4: 161
1132083198_1132083201 -9 Left 1132083198 15:98884865-98884887 CCAAACTCCTATTGCTGGATTAA 0: 1
1: 0
2: 0
3: 8
4: 166
Right 1132083201 15:98884879-98884901 CTGGATTAAAAGGCTGTTCCAGG 0: 1
1: 0
2: 1
3: 11
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132083201 Original CRISPR CTGGATTAAAAGGCTGTTCC AGG Intronic
901070156 1:6513001-6513023 CTTGATTAAAAGCCTGCCCCCGG + Intronic
901684264 1:10934989-10935011 CTAGATTGAAAGGCTGTGTCAGG + Intergenic
901721052 1:11197841-11197863 TTTGTTTAAAACGCTGTTCCAGG - Intronic
903197017 1:21697841-21697863 ATGGATCTAAAGGCTTTTCCTGG + Intronic
903831756 1:26179426-26179448 CTGAGGTAAAAGGGTGTTCCAGG + Intronic
905462585 1:38131393-38131415 CTGTATGACAAGCCTGTTCCAGG + Intergenic
905608937 1:39331601-39331623 CTTGATGAAAAGCCTCTTCCAGG - Intronic
908156878 1:61362460-61362482 CTGCCTTAAAATGCTTTTCCAGG + Intronic
908871998 1:68623995-68624017 CTGGATTAAAAGGTTGTTAAGGG + Intergenic
911754130 1:101532941-101532963 CTTGCTTAAAATGCTGTACCTGG + Intergenic
918306393 1:183250595-183250617 TGGGATTAAATGGCTGGTCCAGG - Exonic
918449180 1:184642414-184642436 GTTGATTCAAAGGCTGTTCTAGG - Intergenic
921451550 1:215313924-215313946 CTGAATGAAAATGCTCTTCCTGG - Intergenic
922013450 1:221617379-221617401 CAGGATTGCAAGGCTATTCCAGG - Intergenic
923717184 1:236434869-236434891 CAGGCTTAAAAGCCTGTGCCTGG + Intronic
1062797467 10:355192-355214 CTGGTTTTAAAGCCTCTTCCTGG + Intronic
1063176703 10:3557247-3557269 CTGGAGCAAGAGGCTGGTCCAGG + Intergenic
1066583278 10:36903718-36903740 CTGGCTTCAAAAGGTGTTCCAGG + Intergenic
1070383087 10:75899310-75899332 CTGGATTATAAGGTTCTTCATGG - Intronic
1071511598 10:86265763-86265785 CAGCAATAAAAGGCTGCTCCTGG + Intronic
1075154126 10:119959780-119959802 CTAAATTCAAAGGCTATTCCTGG - Intergenic
1079116805 11:17645398-17645420 TTGGGTTAAAAGGCTTTCCCTGG + Intronic
1082877617 11:58003932-58003954 TTGGTTTTAAGGGCTGTTCCTGG + Intergenic
1083183484 11:61003803-61003825 CTGGATGGAAAGACGGTTCCAGG + Intronic
1085572823 11:77574089-77574111 CTGGTTTAAAGGGGTGTTCTGGG - Intronic
1086004399 11:82020280-82020302 ATGGATTAAAAGGCTATATCTGG + Intergenic
1086394917 11:86405330-86405352 TGGCATTAAAAGGCTATTCCAGG - Intronic
1088731380 11:112686927-112686949 CTTTATTCAAAGGCTTTTCCTGG + Intergenic
1089012151 11:115140081-115140103 CTGGATGGAGAAGCTGTTCCTGG - Intergenic
1092102471 12:5896840-5896862 CTGGATTAAAAGGGTAATTCGGG + Intronic
1094217259 12:27956556-27956578 CTGGAGTAAAAGGCTCTTAAAGG + Intergenic
1098378269 12:69840989-69841011 CTGAATTAAAAGACTGTCTCTGG - Intronic
1099511417 12:83543550-83543572 CTGCATAAAAAGGCTGTACGTGG - Intergenic
1100521236 12:95378141-95378163 GTAGATAAAAAGGCTGTACCAGG - Intronic
1101264597 12:103070543-103070565 GTGGATTAAGAGGCTGTGTCGGG - Intergenic
1104271671 12:127287900-127287922 CTGGATTAAAAGGATTTTCCTGG + Intergenic
1104952462 12:132447699-132447721 CTGGCTTAAAAGACTGTCCTGGG - Intergenic
1105475367 13:20723949-20723971 CTGCTTTAAAAGGCAGTTCTGGG - Intergenic
1110826079 13:79973919-79973941 CTGGATGAAGAGGCTCTGCCTGG - Intergenic
1115283371 14:31690049-31690071 CTGCATTAAAAACCTGTTCAAGG - Intronic
1116682017 14:47984129-47984151 CTGTATTACAAGGCTGTTTCAGG - Intergenic
1116749044 14:48858936-48858958 CTGGATTAGACAGCTGTCCCGGG - Intergenic
1117313444 14:54551102-54551124 CTGGATTCAACTGCTGCTCCTGG - Intergenic
1120527683 14:85596088-85596110 CTATTTTAAAAGGCTCTTCCTGG - Intronic
1120989032 14:90358807-90358829 CTTGTTTAAAAAGCTGGTCCTGG + Intergenic
1125647296 15:41283346-41283368 CTGGATTAAAAGCCTGGGCGCGG + Intergenic
1128176200 15:65558028-65558050 CTTGAAGAAATGGCTGTTCCAGG - Intronic
1128560407 15:68661704-68661726 CTGCATTAAAAACCTGTTCAGGG + Intronic
1129931849 15:79417813-79417835 GTGGATTAAAAGTTGGTTCCTGG + Intronic
1130912624 15:88281539-88281561 CTGGAGTTCAAGGCTGTCCCAGG - Intergenic
1132083201 15:98884879-98884901 CTGGATTAAAAGGCTGTTCCAGG + Intronic
1132407182 15:101550722-101550744 CTAGAATGAAAGGCAGTTCCCGG - Intergenic
1138247000 16:55475166-55475188 CTGGGCTAAAAGGCAGATCCAGG - Intronic
1138607189 16:58096960-58096982 CTGGAGGAAAAGGCTGAGCCGGG + Intergenic
1140655061 16:77131961-77131983 TTGGATTAAAGGTTTGTTCCTGG + Intergenic
1142399115 16:89850134-89850156 CCGGATGAAAAGGATGTTCCCGG - Intronic
1142951180 17:3481758-3481780 CTGAATTAAAAAGTTATTCCTGG - Exonic
1143829189 17:9637594-9637616 CTGGTTTAAAATGCAGATCCTGG + Intronic
1149557855 17:57587020-57587042 CTGGGTAAAAACGCAGTTCCTGG + Intronic
1150684856 17:67312283-67312305 CTGGATTAAAACGCTGTAATGGG - Intergenic
1151896083 17:76981851-76981873 GGGGATTAAAAGGCTGTTTTAGG - Intergenic
1157675114 18:49562794-49562816 CAAGATTAAAAGGCAGCTCCAGG - Intronic
1159893529 18:73974973-73974995 CTGGAATAACAGGATGTTTCAGG - Intergenic
1159982549 18:74803156-74803178 CTGAAATACAAGGCTGTTACAGG - Intronic
1162164904 19:8745750-8745772 CAGGATGAAGTGGCTGTTCCTGG + Intergenic
1162165975 19:8753214-8753236 CAGGATGAAGTGGCTGTTCCTGG + Intergenic
1162167041 19:8760670-8760692 CAGGATGAAGTGGCTGTTCCTGG + Intergenic
1162168106 19:8768138-8768160 CAGGATGAAGTGGCTGTTCCTGG + Intergenic
1162169047 19:8774426-8774448 CAGGATGAAGTGGCTGTTCCTGG + Intergenic
1162169727 19:8779738-8779760 CAGGATGAAGTGGCTGTTCCTGG + Intergenic
1162170792 19:8787194-8787216 CAGGATGAAGTGGCTGTTCCTGG + Intergenic
1163868824 19:19800858-19800880 CAGGATTAAAAACCTGTTTCAGG + Intronic
1163925858 19:20342844-20342866 CAGGATTAAAAAACTGTTACAGG + Intergenic
925971710 2:9110870-9110892 CTGACTTAAAAGGGTGTTCAGGG + Intergenic
927546685 2:23960300-23960322 CTTGCTTACAAGGCTGGTCCTGG - Intronic
928220086 2:29396210-29396232 CTGGATAATAACGCTGTTGCAGG + Intronic
929372396 2:41241927-41241949 CTGAGTTACAAGGCTGTTTCAGG + Intergenic
929861868 2:45684982-45685004 CTGGTTAGAAAGTCTGTTCCTGG + Intronic
929914877 2:46126629-46126651 TCAGATTAAAAGGCTTTTCCTGG + Intronic
930047517 2:47186197-47186219 CTTGAATAAAATGCTGATCCTGG - Intergenic
930301672 2:49623466-49623488 CTGAATTCAAAGTCTGATCCAGG - Intergenic
930709530 2:54537357-54537379 CTGGTATAAAAGGATCTTCCGGG - Intronic
931019087 2:58022305-58022327 CTCAATTCACAGGCTGTTCCTGG - Intronic
931203016 2:60118812-60118834 CTGGAGTAAGAGGATGTTCTAGG - Intergenic
934518208 2:95002201-95002223 GTGGATCAAAAGCCTGTGCCAGG - Intergenic
934894568 2:98103052-98103074 ATGCATTAAAAGGCTGTTAAGGG - Intronic
935289705 2:101599664-101599686 CTGGATTATAAGGTTTGTCCTGG + Intergenic
936971594 2:118181676-118181698 CAGGACTAAAAAGCTGGTCCAGG - Intergenic
937804960 2:126128707-126128729 CTGGTGTACAAGGCTGTTTCTGG - Intergenic
938825222 2:134997985-134998007 TTGGATTATAAGGTTGTTCCTGG + Intronic
942710111 2:178824700-178824722 CAGGTTTAACAGGATGTTCCTGG - Intronic
945759713 2:213899513-213899535 ATGGATTTAAAGCCTCTTCCAGG + Intronic
948233472 2:236369495-236369517 CTGGATTTAACGGTTGTTACAGG - Intronic
1171841566 20:30218951-30218973 CTGAATTAAACAGCTGTTCTTGG + Intergenic
1172696087 20:36823965-36823987 CCGGATGAGAAGGCTGTGCCAGG + Intronic
1174971851 20:55285215-55285237 CTGAATTAAAAGGCAGTTCTGGG + Intergenic
1177124833 21:17182538-17182560 GGGTATTAAAGGGCTGTTCCAGG - Intergenic
1183117629 22:35703894-35703916 CTCTATGAAATGGCTGTTCCTGG - Intergenic
1183916657 22:41125999-41126021 ATGGACAAAAAGGCAGTTCCTGG + Exonic
1185020277 22:48370482-48370504 CTGGATTTGGAGGCTCTTCCAGG - Intergenic
1185052533 22:48561372-48561394 GTAGATGACAAGGCTGTTCCAGG + Intronic
949828205 3:8185286-8185308 CAGGAGGAAAAGGCTGTTCAAGG + Intergenic
950364148 3:12471317-12471339 CTGGATTCAAAGCCTGCTTCTGG - Intergenic
952012475 3:28916336-28916358 CAGGATTAAAAAATTGTTCCAGG - Intergenic
952180017 3:30907356-30907378 CTGGTTTAAAATGCAGGTCCTGG - Intergenic
953574060 3:44098580-44098602 CTGGATTAGGAGGCTGCTCTTGG - Intergenic
955252003 3:57292896-57292918 CTGGAATAAAATGCTTTTGCAGG + Intergenic
956309508 3:67863657-67863679 TTGGATTAAAAGGCCCATCCTGG + Intergenic
958118060 3:89248211-89248233 CTGTATGAAAATGTTGTTCCTGG + Intronic
960240149 3:115331339-115331361 CTGGAAAAAATGGGTGTTCCTGG + Intergenic
962383069 3:134912468-134912490 ATTGATTTAAAGGCTGTTTCTGG + Intronic
964423891 3:156532259-156532281 GTGGGTTGAAAGGATGTTCCTGG + Intronic
964876880 3:161377343-161377365 CTGGAGTTAGAGGTTGTTCCAGG + Intergenic
967550811 3:190793546-190793568 CTGGTTTACAAGTCTGTTCTGGG - Intergenic
968750557 4:2386906-2386928 CTGGACTAGGAGGCTGCTCCGGG - Intronic
970719744 4:18972539-18972561 CTGGATTAAAGGGGGTTTCCTGG - Intergenic
975399670 4:73919987-73920009 CTGGAATAAAAAGCTATTCCAGG + Intergenic
976225412 4:82791955-82791977 TTGGATTTAAAAGCTGTGCCTGG + Intronic
980303161 4:131020463-131020485 GTGGATTAGAATGTTGTTCCTGG - Intergenic
984088454 4:175340942-175340964 ATGCATTAAGAGGCTTTTCCTGG - Intergenic
985647406 5:1091413-1091435 CTGGAGCTAAAGCCTGTTCCCGG + Intronic
990199801 5:53358609-53358631 ATGGATTAGAAGACTCTTCCAGG - Intergenic
991702137 5:69326136-69326158 CTGGATTAAAAATCTGTCTCTGG - Intronic
994023789 5:95058935-95058957 CTGGGTGAAAAGGGTGGTCCTGG - Intronic
994947698 5:106417000-106417022 CTGGTAGAAAAGCCTGTTCCAGG - Intergenic
995369408 5:111402022-111402044 CTGGATTCAACTGTTGTTCCTGG + Intronic
995822795 5:116256131-116256153 CTTTATTAAAATGCTGTACCTGG + Intronic
997161936 5:131618079-131618101 CTGGCATAAAAAGATGTTCCAGG - Intronic
1001204338 5:169748005-169748027 CTGAATGAAGAGGCTGTTTCAGG + Intronic
1002108581 5:176892741-176892763 CTGGATAATAAGGCCGCTCCAGG + Intronic
1003190404 6:3869607-3869629 CTGGCTTTCAAGGCAGTTCCAGG - Intergenic
1004894057 6:20129591-20129613 CTGCATTTAAGGGATGTTCCAGG + Intronic
1005599871 6:27415665-27415687 AGGGACTAAAAAGCTGTTCCAGG + Intergenic
1005807238 6:29486443-29486465 CTGGATTTGGAGGATGTTCCAGG + Intergenic
1006589828 6:35146474-35146496 CTGGTTTAAAAGGCTCTCTCAGG - Intronic
1007474169 6:42107798-42107820 CAGGCTTCAAAGGCTGTGCCAGG - Intronic
1007991730 6:46262859-46262881 CTGGAGGAAAAGGCTGTTACTGG - Intronic
1008438371 6:51502932-51502954 TTGGTTTAAACGGCTGATCCTGG + Intergenic
1011554180 6:88557370-88557392 CTGGAGGAACAGGCTGTTCCGGG + Intergenic
1012580355 6:100861542-100861564 CTGGATGAAAATGCTGATACTGG - Intronic
1014743561 6:125173247-125173269 CTTAATTACAAGGCTGTTTCTGG + Intronic
1015351345 6:132224016-132224038 CTGGAATAAAAGGCCATGCCAGG + Intergenic
1017463812 6:154676072-154676094 CTGGATTTTGAGGCTGTTTCTGG + Intergenic
1019215960 6:170444040-170444062 CTGGGTCATAAGGCTGTGCCTGG + Intergenic
1020628704 7:10615084-10615106 CTGGGTCACAAGGCTGTTTCGGG - Intergenic
1020667172 7:11060695-11060717 CTGCATTTAAAGGCCTTTCCTGG + Intronic
1021236791 7:18152508-18152530 CTTGTTTAAAATGCTGTTTCTGG + Intronic
1022389016 7:29927513-29927535 CTGGATCAGAGGGCTGCTCCTGG + Intronic
1023727825 7:43162717-43162739 CTGTATTAAAAGGCATTCCCAGG - Intronic
1028113114 7:86966738-86966760 CTGTATTACAAGGCTGATCAAGG + Intronic
1031077439 7:117226399-117226421 CGAGATAAATAGGCTGTTCCAGG + Intronic
1031645982 7:124225651-124225673 CAGGATTAAAGGGATGTTCAAGG + Intergenic
1032838454 7:135695375-135695397 CTGGATGCACTGGCTGTTCCTGG - Exonic
1037925908 8:22844206-22844228 CTGGATTGCAAGGCTGTACCCGG + Intronic
1041834403 8:62195690-62195712 CTGGATTAAAGGTCTGTGCTGGG - Intergenic
1042515088 8:69650821-69650843 CTGGCCTAAAAGCATGTTCCAGG + Intronic
1044347321 8:91120445-91120467 CTGGATAAAGAGGTGGTTCCAGG + Intronic
1046076593 8:109319591-109319613 CTGAATTAAAAGTATGCTCCAGG + Intronic
1051521639 9:17995803-17995825 CTGGATAAAAATGCTGGTGCTGG + Intergenic
1052111816 9:24595064-24595086 TTGGTTTAAAAGCCTATTCCTGG - Intergenic
1055251155 9:74307300-74307322 CTGCATTACAAGGCTGTTATGGG + Intergenic
1055369313 9:75580251-75580273 CTGGATGAAAAGGCTGTGGGAGG - Intergenic
1059867589 9:118533637-118533659 CTAGATTAAATGGCTTTTTCAGG - Intergenic
1059925021 9:119200749-119200771 CTGCATTGAAAGGCTGTTTCAGG - Intronic
1061787430 9:133038385-133038407 GGGGAGAAAAAGGCTGTTCCTGG - Intronic
1186548653 X:10478838-10478860 CGGGATTAAAAGTTTGTTCTGGG + Intronic
1189884747 X:45530596-45530618 CTGCATTAAAAACCTGTTCAGGG - Intergenic
1192248037 X:69389258-69389280 ATGGATTACAAGGCTGGCCCAGG + Intergenic
1195013323 X:100753993-100754015 CTAGCTCAAAAGGGTGTTCCAGG - Intergenic
1196036141 X:111147306-111147328 CTGGAATAACAAGCTGTTTCTGG - Intronic
1196181679 X:112698790-112698812 CTGGGTTTCAAGGCTGTTCTTGG + Intergenic
1196408734 X:115394068-115394090 CTGGAATTAAAGGCTGGGCCTGG - Intergenic
1197117307 X:122848919-122848941 CAGGATAAAAAGGCTGTTCTAGG - Intergenic
1199068353 X:143446946-143446968 ATGGATAAAATGGCTCTTCCTGG + Intergenic