ID: 1132083586

View in Genome Browser
Species Human (GRCh38)
Location 15:98887862-98887884
Sequence ACCTTTCTGATACGAAGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 121}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132083576_1132083586 22 Left 1132083576 15:98887817-98887839 CCCTACCCTCTCTGATCATCATG 0: 1
1: 0
2: 1
3: 12
4: 208
Right 1132083586 15:98887862-98887884 ACCTTTCTGATACGAAGGTCTGG 0: 1
1: 0
2: 0
3: 4
4: 121
1132083578_1132083586 17 Left 1132083578 15:98887822-98887844 CCCTCTCTGATCATCATGTCCCT 0: 1
1: 1
2: 5
3: 31
4: 307
Right 1132083586 15:98887862-98887884 ACCTTTCTGATACGAAGGTCTGG 0: 1
1: 0
2: 0
3: 4
4: 121
1132083577_1132083586 21 Left 1132083577 15:98887818-98887840 CCTACCCTCTCTGATCATCATGT 0: 1
1: 0
2: 0
3: 19
4: 234
Right 1132083586 15:98887862-98887884 ACCTTTCTGATACGAAGGTCTGG 0: 1
1: 0
2: 0
3: 4
4: 121
1132083582_1132083586 -2 Left 1132083582 15:98887841-98887863 CCCTTGCACTGCGGCCAGGTAAC 0: 1
1: 0
2: 4
3: 97
4: 2062
Right 1132083586 15:98887862-98887884 ACCTTTCTGATACGAAGGTCTGG 0: 1
1: 0
2: 0
3: 4
4: 121
1132083583_1132083586 -3 Left 1132083583 15:98887842-98887864 CCTTGCACTGCGGCCAGGTAACC 0: 1
1: 0
2: 0
3: 6
4: 115
Right 1132083586 15:98887862-98887884 ACCTTTCTGATACGAAGGTCTGG 0: 1
1: 0
2: 0
3: 4
4: 121
1132083579_1132083586 16 Left 1132083579 15:98887823-98887845 CCTCTCTGATCATCATGTCCCTT 0: 1
1: 1
2: 4
3: 28
4: 297
Right 1132083586 15:98887862-98887884 ACCTTTCTGATACGAAGGTCTGG 0: 1
1: 0
2: 0
3: 4
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132083586 Original CRISPR ACCTTTCTGATACGAAGGTC TGG Intronic
903874618 1:26464943-26464965 TCCATTCAGATACCAAGGTCTGG - Intronic
906904746 1:49877640-49877662 ATCATTCTGATACCAAAGTCGGG - Intronic
907703080 1:56808496-56808518 ACCTTTCTCACAAGAAGGTCTGG - Intronic
908287818 1:62628021-62628043 ACCTTTCTGGCACCAAGGACTGG + Intronic
908853950 1:68402747-68402769 CCCTTTCTAATGCCAAGGTCAGG + Intergenic
909190032 1:72539744-72539766 ACCTTTCAGAAACCAAAGTCTGG - Intergenic
909625199 1:77707657-77707679 ACCCTTCAGAAATGAAGGTCTGG + Intronic
912736866 1:112157279-112157301 ATCTTTCTGATACCAAAGCCGGG - Intergenic
913933632 1:125011234-125011256 ATCATTCTGATACCAAAGTCAGG + Intergenic
914375250 1:147067567-147067589 ATCATCCTGATACGAAGGCCTGG + Intergenic
914966378 1:152261727-152261749 ATCATTCTGATACCAAAGTCTGG - Intergenic
915582430 1:156822760-156822782 ACCTTTTAGCAACGAAGGTCTGG - Intronic
915887100 1:159734069-159734091 ATCATTCTGATACCAAGGCCAGG + Intergenic
916044519 1:160989435-160989457 ACCTTTTTGATACGAAAGGAGGG - Intergenic
917093456 1:171377078-171377100 ACCATTCTGATACCAAAGCCGGG + Intergenic
917582521 1:176393223-176393245 ACCTTTTTGATACCAAGGACTGG + Intergenic
919099027 1:193070981-193071003 ACCCTTCTGATACCAGGGACTGG + Intronic
1066140141 10:32496872-32496894 ACCTTCCTGATACCAAGACCTGG - Intronic
1066233681 10:33464529-33464551 CCCTTTCTCACACTAAGGTCTGG + Intergenic
1071077242 10:81769695-81769717 ATCTTTCTGATACCAAAGCCAGG - Intergenic
1072225028 10:93361051-93361073 ACCTTTCTGTCACCAAGGACCGG + Intronic
1072840244 10:98765329-98765351 ACCTTTCTGTTACTAATTTCTGG - Intronic
1075254528 10:120914480-120914502 ATCATTCTGATACCAAAGTCGGG + Intergenic
1075435356 10:122436135-122436157 ATCTTTCTGATACCAAAGTTTGG + Exonic
1078640135 11:13087039-13087061 ACCATCCTGATACCAAAGTCTGG + Intergenic
1078979547 11:16516838-16516860 ATCATTCTGATACCAAAGTCGGG + Intronic
1079006050 11:16791706-16791728 ACATTTCTGATAGAAAGGCCAGG - Intronic
1086743958 11:90402552-90402574 ATCATTCTGATACCAAAGTCGGG - Intergenic
1098585793 12:72152877-72152899 ACCATTCTGATACCAAAGCCTGG - Intronic
1099700627 12:86077668-86077690 ACCCTTCAGATATGAAGGTTTGG - Intronic
1100092782 12:90992040-90992062 ACCTTTCTGGCACGAGGGACTGG + Intronic
1111662942 13:91234224-91234246 ACCTACCTGATAGGAAGGCCAGG + Intergenic
1117465621 14:55990667-55990689 ATCTTTCTGATACCAAAGCCGGG - Intergenic
1119579403 14:75763444-75763466 ACCTTTCTGATAGGGATTTCTGG - Intronic
1120472613 14:84945419-84945441 ACCTTTTTGTTATGAAGGTTGGG + Intergenic
1123106429 14:105843909-105843931 ACCTTTCTCATGGGAAGCTCTGG + Intergenic
1125923480 15:43541419-43541441 AACTTTTTGAAAAGAAGGTCAGG + Intronic
1126721159 15:51581356-51581378 ACCTTTTTGGTACCAAGGACCGG - Intronic
1128529421 15:68433554-68433576 CCCTTTCTGAAACGATGGGCTGG - Intergenic
1132083586 15:98887862-98887884 ACCTTTCTGATACGAAGGTCTGG + Intronic
1137295124 16:47085004-47085026 ACCTTTTTGGTACCAAGGACTGG - Intronic
1139488373 16:67271940-67271962 ACCTTTCTGATCCTTGGGTCTGG + Exonic
1145878056 17:28334884-28334906 ACCTATCTGATTGGAAGGGCTGG + Intronic
1148225954 17:45897716-45897738 ACCATTCTGAGACGGAGGTTTGG - Intronic
1148635822 17:49148665-49148687 ACCTTCATGACATGAAGGTCGGG + Intronic
1149755615 17:59183042-59183064 ACCTTCCTGATTGGAAGGACTGG - Intronic
1156034057 18:32747203-32747225 ACCTTTTTGGTACCAGGGTCCGG + Intronic
1157253683 18:46118648-46118670 ACCTTTTTGTTAAGTAGGTCAGG + Intronic
1158483084 18:57839510-57839532 ACCTTTCTGATAGGTAGTTGTGG + Intergenic
1162175361 19:8826188-8826210 ACCTTTCTGGTACCAGGGACTGG + Intronic
1163995687 19:21044563-21044585 ATCATTCTGATACCAAGATCTGG - Intronic
1165756664 19:38297280-38297302 ACCTTTCTGGCACCAAGGACTGG + Intronic
926714888 2:15916464-15916486 ACCTTTCTGAGAAGCAGGTCCGG - Intergenic
930306911 2:49686215-49686237 ACCTTTCTGACACCAGGGACTGG + Intergenic
931804974 2:65795633-65795655 AATTTTCTGATACGAGGGTTTGG - Intergenic
943184655 2:184592123-184592145 CCCTTTCTGATAAGAAGATGTGG - Intergenic
944827700 2:203502228-203502250 ACCTCTCTGTTAGGAAGGTTTGG - Intronic
945526321 2:210891926-210891948 ATCATTCTGATACCAAAGTCTGG + Intergenic
945671669 2:212809645-212809667 ACCTTTTTGATACCAGGGACTGG - Intergenic
1169530354 20:6478268-6478290 ACCTTTCTGACACCAGGGACAGG - Intergenic
1175000865 20:55629480-55629502 ACCTTTTCGATACCAAGGACTGG - Intergenic
1180507218 22:16024539-16024561 ATCATTCTGATACGAAAGCCAGG + Intergenic
1181477920 22:23180231-23180253 ACCTTTCCAATACAGAGGTCTGG - Exonic
1183368107 22:37417807-37417829 ACCTTTCTGAGACCCAGGTTGGG - Exonic
1183442752 22:37832540-37832562 CTCTTTCTGATACGAGTGTCTGG + Intronic
951448028 3:22804903-22804925 ATCATTCTGATACCAAGGCCGGG + Intergenic
951505062 3:23435851-23435873 ACCTTTTTGGCACCAAGGTCTGG + Intronic
953506143 3:43487285-43487307 ATCATTCTGATACCAAAGTCAGG - Intronic
953513686 3:43569346-43569368 ATCATTCTGATACCAAAGTCGGG + Intronic
954596713 3:51831124-51831146 ACCCTTCTGATTCCAAGCTCAGG - Intergenic
964536546 3:157728221-157728243 ATCTTTCTGATACCAAAGCCAGG + Intergenic
964612893 3:158632626-158632648 ACCTTTTTGGCACGAAGGACTGG + Intergenic
965391379 3:168108813-168108835 ACCTTTCAGAAATGAAGGTTTGG - Intergenic
966582836 3:181587868-181587890 ATCATTCTGATACGAAAGCCTGG - Intergenic
972427230 4:38944866-38944888 ACCTTTCTGGTACCAGGGACCGG - Exonic
974607952 4:64176898-64176920 ATCTTTCAGATAGGAAGTTCTGG + Intergenic
975075983 4:70209685-70209707 ATCATTCTGATACCAAAGTCTGG - Intergenic
975980020 4:80146666-80146688 ACCTATCTGATATCAAAGTCGGG - Intergenic
977499023 4:97815062-97815084 ACTTTTCAGAAACGAAGGTATGG + Intronic
978153250 4:105462297-105462319 AACTTTCTTATCCGAAGCTCAGG + Intronic
979852483 4:125591125-125591147 ACCTTTCTGACACCAGGGACCGG + Intergenic
982772219 4:159407130-159407152 ACCCTTCTGAAATGAAGGTTTGG + Intergenic
986090381 5:4498829-4498851 ATCATTCTGATACCAAGGCCGGG - Intergenic
987949494 5:24657205-24657227 ATCATCCTGATACCAAGGTCTGG - Intergenic
988770801 5:34431233-34431255 ATCATTCTGATACAAAAGTCTGG - Intergenic
990721042 5:58696404-58696426 ATCATCCTGATACCAAGGTCTGG - Intronic
990792724 5:59499930-59499952 ATCTTTCTGATACCAAAATCTGG + Intronic
991096478 5:62745145-62745167 ACCTTTTTGCCATGAAGGTCAGG + Intergenic
992675496 5:79101949-79101971 ACTTTTCTGATAGGAAGATAAGG + Intronic
995690056 5:114815648-114815670 GTCTTTCTGATACCAAAGTCTGG - Intergenic
995881026 5:116845007-116845029 ACCTTTTTGGTACGAGGGACCGG + Intergenic
996286200 5:121795884-121795906 ACCTTTTTGTTACAAAGGTGGGG - Intergenic
996751408 5:126892770-126892792 ATCATTCTGATACGAAAGCCAGG - Intronic
998489960 5:142538025-142538047 ATCTTTCTGATAGGGAGATCTGG + Intergenic
1012094903 6:94945654-94945676 ATCATTCTGATACCAAAGTCGGG + Intergenic
1018759879 6:166884636-166884658 ACATTTCTGACACCAAGGTATGG - Intronic
1020291018 7:6722205-6722227 ACCTTCCTGATTGGAAGGACTGG - Intergenic
1020365709 7:7378662-7378684 GCCTGTCTGATACCAAGTTCAGG - Intronic
1022934227 7:35155456-35155478 ATCATTCTGATACCAAAGTCTGG + Intergenic
1024796585 7:53028801-53028823 ATCATTCTGATACCAAAGTCGGG - Intergenic
1026076853 7:67179506-67179528 ACTTTACAGATACGAAGGTGAGG - Intronic
1026226390 7:68445810-68445832 CCCTTTCTAATACGAAATTCTGG - Intergenic
1028119672 7:87043271-87043293 ATCATTCTGATACCAAAGTCAGG + Intronic
1029395767 7:100307678-100307700 ACCTTCCTGATTGGAAGGACCGG + Intergenic
1030516133 7:110540742-110540764 ACCTGTTGGATACGGAGGTCTGG - Intergenic
1031988365 7:128178609-128178631 ACCTTCCTGAGACAAAGGGCAGG - Intergenic
1033404984 7:141064499-141064521 ATCATTCTGATACCAAAGTCGGG - Intergenic
1035792487 8:2320167-2320189 ATCATTCTGATACGAAAGCCGGG - Intergenic
1035800318 8:2401538-2401560 ATCATTCTGATACGAAAGCCGGG + Intergenic
1037672896 8:21030234-21030256 AGCTTTCTGATATGAAGCCCAGG + Intergenic
1038829091 8:31036946-31036968 ACCTTTTTGGTACCAAGGACTGG + Intronic
1043194094 8:77268668-77268690 ACCTATCTGATATGAAGGAGAGG - Intergenic
1043241846 8:77944027-77944049 ATCATTCTGATACCAAAGTCAGG + Intergenic
1045689099 8:104742333-104742355 ATCATTCTGATACCAAGGCCGGG - Intronic
1049852651 8:144841478-144841500 ACGTTTCTGATTCTGAGGTCTGG + Exonic
1051260267 9:15257204-15257226 ACCATTCAGATACCAAGATCAGG - Intronic
1051299356 9:15631680-15631702 ATCATTCTGATACGAAAGCCGGG + Intronic
1058864781 9:109151750-109151772 GCCTTTTTGATACCAAGGACTGG - Intronic
1061652809 9:132064829-132064851 TCCTTTCTGACAGGAAGGACTGG + Intronic
1062345550 9:136112863-136112885 AGCCTTCTGATCCGAAGGTCTGG - Intergenic
1186196569 X:7115555-7115577 ACCTTTCTGCTGTGAAGGGCTGG - Intronic
1192243521 X:69354401-69354423 ATCATTCTGATACGAAAGCCTGG + Intergenic
1192433950 X:71131025-71131047 AACTTCCTGATACGAAGGGATGG + Intronic
1193896425 X:87119833-87119855 ACCATTCTGATACCAAAGCCGGG + Intergenic
1198023511 X:132682363-132682385 TCCTTTCAGATCTGAAGGTCTGG - Intronic
1202079228 Y:21067260-21067282 ACCATTCTGATACCAAAGCCGGG + Intergenic