ID: 1132090791

View in Genome Browser
Species Human (GRCh38)
Location 15:98946622-98946644
Sequence GCAGACTGCTCGGGTGGAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 81}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132090785_1132090791 -1 Left 1132090785 15:98946600-98946622 CCAAGGGCATGGGTGACAGCAGG 0: 1
1: 0
2: 3
3: 42
4: 349
Right 1132090791 15:98946622-98946644 GCAGACTGCTCGGGTGGAATGGG 0: 1
1: 0
2: 0
3: 6
4: 81
1132090784_1132090791 8 Left 1132090784 15:98946591-98946613 CCGAGGAGGCCAAGGGCATGGGT 0: 1
1: 1
2: 6
3: 50
4: 294
Right 1132090791 15:98946622-98946644 GCAGACTGCTCGGGTGGAATGGG 0: 1
1: 0
2: 0
3: 6
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132090791 Original CRISPR GCAGACTGCTCGGGTGGAAT GGG Intronic
901828317 1:11877270-11877292 GCAGACAGCTCTGCTGGAACTGG - Intergenic
903971012 1:27118816-27118838 ACAGACTGCTGGGGTAGAACTGG - Intronic
904314266 1:29650211-29650233 GCAGAGGGCTGGGGTGGAAAGGG - Intergenic
909353260 1:74678234-74678256 GCAAACTGATCAGTTGGAATAGG + Intergenic
909709923 1:78637047-78637069 GTAGAATGCTCAGGTGTAATTGG - Exonic
921045772 1:211476990-211477012 GCAGACTGCTCAGCTGGTAGGGG - Exonic
923263117 1:232286134-232286156 GCAGGCAGCCAGGGTGGAATTGG - Intergenic
1065695858 10:28379158-28379180 GCAGATTGCTCGTCTGGAAGAGG - Intergenic
1069756537 10:70777243-70777265 GCCGACAGCCCGGGTGGAAGCGG + Exonic
1073048761 10:100654883-100654905 GCAGATAGCCCGGGTGGAAGCGG + Intergenic
1075821658 10:125318405-125318427 TCAGACTGATAGGCTGGAATAGG - Intergenic
1076672388 10:132130487-132130509 GCAGACTCCTCTGGAGGAAGAGG + Intronic
1078522643 11:12075736-12075758 GAAGACTGCTGGGCTGGATTTGG - Intergenic
1084162442 11:67357082-67357104 CCAGACTGATGGGGTGGAAATGG - Intronic
1084873987 11:72117194-72117216 GCAGGCTGGTCGGGTGGGAGGGG + Intronic
1087353144 11:97059669-97059691 GCAGCCTGCTTGGCTGAAATTGG + Intergenic
1090417369 11:126549797-126549819 GCAGCCTCCTGGGGTGGAAGCGG + Intronic
1098394693 12:70005618-70005640 GCAGCCTGCTAGGCTAGAATTGG + Intergenic
1109019214 13:57063363-57063385 GCAGTTTGCTCAGGTGGAAATGG + Intergenic
1112079927 13:95958789-95958811 GCAGACTGCTAGGCTGGGATTGG + Intronic
1119773758 14:77236371-77236393 GCAGACTGGTGGGGGGGTATGGG + Intronic
1119777314 14:77257165-77257187 TCAGACTGCAGGGGAGGAATGGG - Exonic
1120662620 14:87268661-87268683 TCAGGCTTCTCAGGTGGAATCGG - Intergenic
1129412540 15:75358131-75358153 GGAGACTGCTTGTGTGGAACAGG - Intronic
1131036083 15:89222843-89222865 GCAGCCTGCTCTGGAGGAAGGGG - Intergenic
1131695459 15:94872607-94872629 GCAGACTTCTAATGTGGAATGGG - Intergenic
1132090791 15:98946622-98946644 GCAGACTGCTCGGGTGGAATGGG + Intronic
1135955264 16:26951664-26951686 GCAGATTGCCCGGGAAGAATTGG - Intergenic
1141700303 16:85639248-85639270 CCAGACTCCTCGGGTGGCACCGG + Intronic
1142478086 17:201536-201558 GCAGACGTCTGGGGTGGGATGGG + Intergenic
1142478105 17:201619-201641 GCAGACGTCTGGGGTGGGATGGG + Intergenic
1142478124 17:201702-201724 GCAGACGTCTGGGGTGGGATGGG + Intergenic
1142478143 17:201785-201807 GCAGACGTCTGGGGTGGGATGGG + Intergenic
1146791227 17:35751726-35751748 GCAGCCTGATTAGGTGGAATGGG - Intronic
1157337274 18:46750617-46750639 GAAGAGGGCTCGGGTGGGATAGG - Intronic
1157608193 18:48939465-48939487 GCAAACTGCCCGGGAGGAAGGGG - Intronic
1159292556 18:66440675-66440697 CCAGGCTGAGCGGGTGGAATGGG + Intergenic
926005889 2:9373279-9373301 GCTGCCTGCTCAGGTGGAACGGG + Intronic
926211041 2:10869474-10869496 GCAGAATGCACGGGTGGGCTGGG + Intergenic
926672462 2:15589087-15589109 GCAGGCTTCTGGCGTGGAATAGG - Intergenic
937114089 2:119391868-119391890 GCAGAATGGTCTGGTGGAATGGG + Intergenic
942290998 2:174470613-174470635 GCAGGCTGCTCTGGTGAATTTGG + Intronic
945318172 2:208392828-208392850 GCAGACTGAGCCGCTGGAATGGG + Intronic
946657066 2:221960078-221960100 AGAGACTGCTCGGTGGGAATGGG + Intergenic
1169539560 20:6584134-6584156 GCAAACTGCTCCGGTTGAAAGGG + Intergenic
1170656423 20:18291099-18291121 GAAGAATGCACAGGTGGAATAGG - Intronic
1179477135 21:41654227-41654249 GCAGACTGTCCGGGTGGTCTGGG + Intergenic
1180125420 21:45786946-45786968 GCAGCCTGCTGGGATGGAAAGGG + Intronic
1184794155 22:46721867-46721889 CCAGGTGGCTCGGGTGGAATGGG - Intronic
952656179 3:35788456-35788478 TCACACTGCTTGGGTGGACTGGG + Intronic
953370320 3:42382177-42382199 GCAGCCTGCTTTGGTGGATTGGG + Intergenic
954643090 3:52113999-52114021 GCAGAATGCTGGGGAGAAATCGG + Intronic
960161041 3:114350840-114350862 GCAGCCTGCTCGGGTTGGGTGGG + Exonic
962217282 3:133533481-133533503 GCAGACTGCTGTGGTGGGCTAGG + Intergenic
969073578 4:4559126-4559148 GCAGGCAGCAGGGGTGGAATTGG + Intergenic
974889333 4:67860618-67860640 GCAGAATGCTTGGGTGATATAGG + Intronic
978919599 4:114166691-114166713 GCAGGGTGCTAGGGTGAAATGGG + Intergenic
982442063 4:155447942-155447964 GCAGACACCTCGTGTGGAGTTGG + Intergenic
988018698 5:25595962-25595984 GGAGAATCCTCAGGTGGAATGGG + Intergenic
991632254 5:68667851-68667873 GGAGAATGCTAGGGTGGATTAGG + Intergenic
994578254 5:101608880-101608902 GGAGAGGGCTCAGGTGGAATAGG - Intergenic
997671735 5:135680054-135680076 GCAGCCTGCTTGGCTGGGATTGG - Intergenic
999655163 5:153803996-153804018 GCAGATTGCTAGGGTGGGAGTGG - Intronic
1003424105 6:5985359-5985381 GCTGACTGCTCTGGTCGAAGTGG + Intergenic
1004020462 6:11771521-11771543 GCAGACCGTTCGGGTGGGATGGG - Intronic
1014088912 6:117380686-117380708 GCTGACTGCTGTGGAGGAATGGG - Intronic
1020248364 7:6448026-6448048 GCAGACAGCTCCGGCGGAAGAGG - Intronic
1029435687 7:100562845-100562867 GAAGGCTGCCCAGGTGGAATGGG - Exonic
1029693623 7:102199031-102199053 GCAGGCAGCTCGGGAGGAAGGGG - Intronic
1030971082 7:116056289-116056311 GCAGACTCCTCGAGTTGAGTTGG + Intronic
1034433570 7:151052539-151052561 GCAGAGTGCTGGGGTGGGAACGG - Exonic
1034436176 7:151063687-151063709 GCAGACTGCTTGGGAGGACTGGG + Intronic
1035068484 7:156124520-156124542 GCAGAGGGCTCGGGAGGAACTGG - Intergenic
1041830409 8:62147247-62147269 GCAGCCTGCTTGGCTGGGATTGG + Intergenic
1044077030 8:87834517-87834539 GCAGTTTGCTGGGGTGAAATAGG - Intergenic
1049758703 8:144322167-144322189 GCATACTGCACAGGTGGAAGAGG + Intronic
1051108084 9:13603612-13603634 GCAGAATGCTTGGGTGGGGTTGG + Intergenic
1052772030 9:32698784-32698806 GGACACTGCTCTGGTGGAACCGG + Intergenic
1055309496 9:74964258-74964280 GCAGCCTGCTCAGCTGGGATTGG + Intergenic
1059849053 9:118316646-118316668 CCAGACTTCTCTGTTGGAATAGG - Intergenic
1061234923 9:129336711-129336733 GCAGCCTGCTCGGGAGGAGGTGG - Intergenic
1062265395 9:135684544-135684566 GGAGAGTGTTGGGGTGGAATTGG - Intergenic
1062310990 9:135937118-135937140 CCAGCCTGCTCGGGTGGCAAAGG + Intronic
1186207354 X:7214638-7214660 GTATACTGCTCGGGTGTGATGGG - Intergenic
1186457015 X:9717633-9717655 ACCGACTGCTCGGCTGGATTAGG + Exonic
1194872192 X:99146380-99146402 GCAGCCTGCTTGGCTGGAATTGG + Intergenic
1197309377 X:124884585-124884607 GCAGCCTGCTCAGCTGGAATGGG - Intronic
1201390355 Y:13490570-13490592 GCAGCCTGCTTGGCTGGGATTGG - Intergenic