ID: 1132092273

View in Genome Browser
Species Human (GRCh38)
Location 15:98956298-98956320
Sequence CCCCTCCACACGCAAGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 131}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132092273_1132092277 -10 Left 1132092273 15:98956298-98956320 CCTGTCCCTTGCGTGTGGAGGGG 0: 1
1: 0
2: 0
3: 12
4: 131
Right 1132092277 15:98956311-98956333 TGTGGAGGGGACTCGTGCCCAGG 0: 1
1: 0
2: 0
3: 12
4: 157
1132092273_1132092284 19 Left 1132092273 15:98956298-98956320 CCTGTCCCTTGCGTGTGGAGGGG 0: 1
1: 0
2: 0
3: 12
4: 131
Right 1132092284 15:98956340-98956362 CTTGCTGGCTTGTTGGAATCTGG 0: 1
1: 0
2: 0
3: 11
4: 143
1132092273_1132092279 4 Left 1132092273 15:98956298-98956320 CCTGTCCCTTGCGTGTGGAGGGG 0: 1
1: 0
2: 0
3: 12
4: 131
Right 1132092279 15:98956325-98956347 GTGCCCAGGGCTCTCCTTGCTGG 0: 1
1: 0
2: 3
3: 28
4: 302
1132092273_1132092282 12 Left 1132092273 15:98956298-98956320 CCTGTCCCTTGCGTGTGGAGGGG 0: 1
1: 0
2: 0
3: 12
4: 131
Right 1132092282 15:98956333-98956355 GGCTCTCCTTGCTGGCTTGTTGG 0: 1
1: 0
2: 0
3: 14
4: 228
1132092273_1132092278 -9 Left 1132092273 15:98956298-98956320 CCTGTCCCTTGCGTGTGGAGGGG 0: 1
1: 0
2: 0
3: 12
4: 131
Right 1132092278 15:98956312-98956334 GTGGAGGGGACTCGTGCCCAGGG 0: 1
1: 0
2: 0
3: 10
4: 141
1132092273_1132092285 26 Left 1132092273 15:98956298-98956320 CCTGTCCCTTGCGTGTGGAGGGG 0: 1
1: 0
2: 0
3: 12
4: 131
Right 1132092285 15:98956347-98956369 GCTTGTTGGAATCTGGCTTCAGG 0: 1
1: 0
2: 1
3: 13
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132092273 Original CRISPR CCCCTCCACACGCAAGGGAC AGG (reversed) Intronic
900112393 1:1013917-1013939 GCCCACCACACACAAGGCACTGG - Intronic
903072363 1:20732625-20732647 ACCCTCCACTCACAAGGGCCGGG - Intronic
907222293 1:52915721-52915743 CCCACCCACATGCAAGGGAGGGG - Intronic
908340513 1:63173660-63173682 CCCCTCAACAAACAAGGGACTGG - Intergenic
912798638 1:112707258-112707280 CCCCTCCGCAGGCCGGGGACTGG + Intronic
913530765 1:119732770-119732792 CCCCTCCACAGACAGGTGACTGG - Intronic
920338771 1:205262376-205262398 CCCCTCCACACACCAGGCCCAGG + Intronic
920498716 1:206473061-206473083 CCATTCCACAAGCAAGGGAGCGG - Intronic
922770157 1:228177303-228177325 CCCAGCCACACCCACGGGACAGG - Exonic
923678940 1:236103404-236103426 CCCCTCCTCAGACAAGGGGCTGG + Intergenic
1064433362 10:15290226-15290248 AGCCACCACACTCAAGGGACAGG + Intronic
1067173583 10:43926922-43926944 CACCTCCACAGGGCAGGGACAGG - Intergenic
1067406731 10:46030383-46030405 CCCCTCCACACGCCAGGCCCGGG - Intronic
1069532072 10:69227038-69227060 CCCCTCCTCAGGCAGAGGACAGG - Intronic
1072544389 10:96423324-96423346 CCCCTCCACCTGCAAGGTGCTGG + Intronic
1073108618 10:101047744-101047766 CCCCTGCACACGTGAGGCACAGG + Intergenic
1074382767 10:112993674-112993696 CCCCTCTACAAGAGAGGGACAGG + Intronic
1074864039 10:117534876-117534898 CTCCTCCAGACGCCAGGGGCAGG + Intergenic
1075002378 10:118808332-118808354 TCCCACCCCACCCAAGGGACAGG + Intergenic
1075242745 10:120793103-120793125 TCCCTCCACACACACTGGACTGG + Intergenic
1075809472 10:125214541-125214563 CCAGCCCACACTCAAGGGACAGG + Intergenic
1076538607 10:131199074-131199096 CCCTTCCACCCTCAAGGGCCTGG + Intronic
1076883131 10:133249234-133249256 CCCCTCCCCACTCAGGGGACAGG - Intergenic
1077092849 11:787539-787561 CCCCTCCACACGCAGGCTTCAGG + Exonic
1077192885 11:1262812-1262834 CGCCTCCACACGCACGGGCAGGG + Intergenic
1083427086 11:62593789-62593811 CCCTTCGACACGAAAGGGAAGGG + Exonic
1084668625 11:70592216-70592238 TCCCTCTGCACGCAGGGGACAGG + Intronic
1091447542 12:552654-552676 TCCCTTCACACCCAAGGGAGTGG + Intronic
1091601112 12:1918266-1918288 CCTGTCCCCACGCAGGGGACAGG + Exonic
1096438607 12:51618312-51618334 CCCCTAGACACGAAAGGGAAGGG - Intronic
1096875871 12:54630045-54630067 CCCCTCCCCAGGCCAGGCACAGG - Intergenic
1104323585 12:127774631-127774653 TCCCTCCACACGCCAGGGCAGGG + Intergenic
1104921325 12:132292209-132292231 CCCCTCAACGTGCAAGAGACAGG + Intronic
1106287122 13:28327881-28327903 CCGCTCTACTCGCAAGGGTCTGG - Intronic
1107635072 13:42383887-42383909 CCCATCCACACTCAAGGGGAGGG + Intergenic
1114460518 14:22883531-22883553 CCCCTGCTCACACAAGGGATTGG + Intronic
1119428302 14:74550164-74550186 CCCATCCACACACAAGGTTCAGG - Intronic
1119636642 14:76278701-76278723 CCGCTCAACAAGCATGGGACAGG + Intergenic
1121015594 14:90547004-90547026 CCTCTCCACACACAGGGGAGGGG - Intronic
1121572643 14:94958733-94958755 CCAGTCCACACTCAAGGGAGCGG - Intergenic
1121826202 14:97011538-97011560 CCCCTTCACAATCCAGGGACAGG - Intergenic
1122037159 14:98957231-98957253 CCCCTCCTCAGGCCAGGGTCTGG + Intergenic
1124631304 15:31339061-31339083 CCTCCCAACACCCAAGGGACAGG - Intronic
1125843100 15:42824115-42824137 CCCCTCCGCTCCCAAGGGAGGGG + Intronic
1126482033 15:49135346-49135368 CCCTTCCACATGCCAGGCACTGG + Intronic
1129827275 15:78641903-78641925 TCCCCCCACCCGCAAGGGAATGG - Intronic
1132092273 15:98956298-98956320 CCCCTCCACACGCAAGGGACAGG - Intronic
1132482724 16:174561-174583 CCCCTCCACACTCACAGTACTGG + Intergenic
1132726839 16:1342576-1342598 TCCCTGCACACGCGAGGCACTGG - Exonic
1134517533 16:14899196-14899218 ACCCGCCACATGCCAGGGACTGG - Intronic
1134705201 16:16297847-16297869 ACCCGCCACATGCCAGGGACTGG - Intergenic
1134962340 16:18414267-18414289 ACCCGCCACATGCCAGGGACTGG + Intergenic
1134966637 16:18496866-18496888 ACCCGCCACATGCCAGGGACTGG + Intronic
1139959607 16:70710098-70710120 CCCTGCCACCCGCATGGGACAGG + Intronic
1140769458 16:78190190-78190212 CTTCTCCACAGGCTAGGGACTGG - Intronic
1141745380 16:85922295-85922317 CCCCTCCACAGGCATGGTGCTGG - Exonic
1141823241 16:86462275-86462297 CCAGGCCACACGCAAGGGAGGGG - Intergenic
1142399400 16:89851448-89851470 CCCCTCCACCTGTAAGGGGCAGG - Intronic
1142669113 17:1479396-1479418 CCCCTCCACACCCGAGGGCAAGG + Intronic
1144738081 17:17566031-17566053 CTCCTCCAGACTCAAGGGAAGGG + Intronic
1145264623 17:21373877-21373899 CCCCTCCACACTGTAGGGGCAGG + Intergenic
1146267302 17:31461230-31461252 CCCCTCCACACGCACAAGCCTGG + Intronic
1146539784 17:33684309-33684331 CCCCTCCCCACCCCAGGGTCGGG - Intronic
1148090482 17:45020065-45020087 CCCCTCTACCCTCAAAGGACTGG - Intergenic
1149037597 17:52153101-52153123 CCTCTCCCCAGCCAAGGGACTGG + Intronic
1151292563 17:73161160-73161182 CCCCTCCCCATGGAAGGGGCTGG + Intergenic
1151584970 17:75003392-75003414 CTCCTGCACACGCAGGCGACAGG - Exonic
1152309429 17:79540581-79540603 CTCCTCCACACAGAAGGGCCCGG + Intergenic
1153939220 18:9962925-9962947 CCCCTCCACATCCAATGAACAGG - Intergenic
1157401719 18:47394214-47394236 CCACTCCACACACCTGGGACAGG - Intergenic
1161237117 19:3203765-3203787 CTCCTCCAGACGCAAAGAACAGG - Exonic
1162340226 19:10087310-10087332 CCCCTCCCCTCGCAAAGGACCGG + Intronic
1165828736 19:38720100-38720122 GCCCTCCACACCCCAGGGTCTGG + Intronic
1167335834 19:48885267-48885289 CTCCTTGACAGGCAAGGGACTGG - Intronic
1168275077 19:55273489-55273511 CTCCTCCACACGGGAGGGATCGG - Intronic
925384449 2:3452381-3452403 CCAGGCCACACGCAAGGGATGGG + Intronic
927442490 2:23129103-23129125 CACCTCCACACCCAAGGGATGGG + Intergenic
927652100 2:24919377-24919399 CCCTTCCACAAGCCAGGGACAGG - Exonic
929892577 2:45930574-45930596 GCCCTCCACAGACAAAGGACAGG - Intronic
930151821 2:48067517-48067539 CCCGTCCACACTCAAGGAAGGGG + Intergenic
931318177 2:61151828-61151850 CCAGTCCACACTCAAGGGAAGGG + Intronic
934553315 2:95275151-95275173 CCCCTCAAGCAGCAAGGGACAGG - Intronic
935202399 2:100869630-100869652 CCCGCCCACACGGAAGGGACAGG - Intronic
937132600 2:119524463-119524485 CTCCTCCACCCGGCAGGGACTGG + Exonic
937857142 2:126680618-126680640 CACCTGCAGAAGCAAGGGACTGG + Intronic
942619221 2:177829837-177829859 CCTGTCCACACTCAAGGGAAAGG - Intronic
948518606 2:238521960-238521982 AGCCTCCACACTCAAGGGCCAGG - Intergenic
949077977 2:242073451-242073473 CCCATCCACACGGAAGGAAAAGG + Intergenic
1170811009 20:19674631-19674653 CCAGTCCACACTCAAGGGGCTGG + Intronic
1171424882 20:25043063-25043085 CCCCTCCCCCTGCCAGGGACAGG + Intronic
1174699258 20:52591008-52591030 CCCCTCCACATGCAGAGGACGGG - Intergenic
1175702190 20:61147633-61147655 CCCCGCCACATGCCAGGCACTGG + Intergenic
1176154451 20:63611237-63611259 CCCTTCCACACACAAGAGCCGGG - Intronic
1176244966 20:64093126-64093148 CCCCTCCACAGGGAGGGGAGGGG + Intronic
1176867484 21:14062343-14062365 CCCCGCCACACGCTGGGGGCTGG + Intergenic
1182522869 22:30894022-30894044 CCCCGCCACAGGCAAAGGAGAGG + Intronic
1183927422 22:41216205-41216227 TTCCTCCACTCTCAAGGGACAGG + Exonic
1185273339 22:49938521-49938543 CCCCTCCCCACCCAAGAGCCAGG + Intergenic
950111654 3:10422524-10422546 CCCCTCCACATGACAGAGACTGG - Intronic
954089982 3:48276612-48276634 CCCCGCCATAAGCAAGGCACGGG - Intronic
954880562 3:53833343-53833365 ACCCTCCCCACACAAGGGAGGGG + Intronic
959823045 3:110759127-110759149 ACCCTCCACACCCAAGGCTCTGG + Intergenic
960089309 3:113623335-113623357 CCCCTTCCCCCTCAAGGGACTGG + Intronic
961674189 3:128555100-128555122 CCCCTCCACACGCAGCCGGCAGG - Intergenic
963870046 3:150406951-150406973 GCCCTCCAAACCCAAGTGACTGG - Intergenic
969299950 4:6291903-6291925 CCCCTCCATCTGCAGGGGACAGG - Exonic
969514227 4:7637658-7637680 CCCCCCCACACACCAGGGAGGGG - Intronic
969696721 4:8739112-8739134 CCCCACCACTCACATGGGACGGG - Intergenic
971646303 4:29209064-29209086 CAACTCCACACACAAGGGAATGG - Intergenic
987119582 5:14754189-14754211 TCCCTCAACAGGCAAGGGCCAGG + Intronic
989205108 5:38802362-38802384 CCCACCCACACTCAAGGGAAGGG + Intergenic
993176787 5:84496781-84496803 CCCACCCACACTCAAGGGAAAGG + Intergenic
998424916 5:142018444-142018466 CACCTCCAGACACAAGGGACTGG - Intergenic
1000809023 5:165837716-165837738 CCCAGCCACACTCAAGGGAGAGG + Intergenic
1003323468 6:5073843-5073865 CCCCGCCACACCCAGGGGAGTGG + Intergenic
1005673963 6:28135445-28135467 CCATTCCACACGAAAGGGAGAGG + Intergenic
1006365638 6:33613547-33613569 ACCTACCACATGCAAGGGACTGG - Intergenic
1006647066 6:35522224-35522246 CCCCACCCCACGCTAGGGGCAGG + Intergenic
1007119577 6:39368875-39368897 CCCCTTCCCACGCAGGGCACTGG - Intronic
1007750639 6:44068669-44068691 CCCCTCCCCAGGCCAGGGAAGGG + Intergenic
1016330402 6:142947179-142947201 TCCCTCTCCACGGAAGGGACCGG + Intergenic
1019355839 7:578352-578374 CCCCACCACAGGCAGGCGACAGG - Intronic
1019382539 7:731921-731943 CCCCTCAACAACCCAGGGACTGG + Intronic
1034406976 7:150911105-150911127 CCCTGCCACACACAAGGGCCTGG + Intergenic
1035302629 7:157907352-157907374 ACACCCCACACGCAGGGGACAGG - Intronic
1035302665 7:157907475-157907497 ACACCCCACACGCAGGGGACAGG - Intronic
1035302677 7:157907516-157907538 ACACCCCACACGCAAGGGACAGG - Intronic
1035302711 7:157907641-157907663 ACACCCCACACGCAGGGGACAGG - Intronic
1035302725 7:157907684-157907706 ACACCCCACACGCAAGGGACAGG - Intronic
1035536515 8:395252-395274 CCCATCCACACGGAAGGAAAAGG + Intergenic
1035752389 8:2005432-2005454 CGGCTCCACACCCCAGGGACTGG - Exonic
1037289241 8:17333862-17333884 CTCCTTCACCCACAAGGGACAGG + Intronic
1048047197 8:130783940-130783962 CCCCTCTACACTCAAGTCACTGG + Intronic
1052749441 9:32474411-32474433 CCCCTTCACACTCAGGGGAGGGG - Intronic
1053269402 9:36739900-36739922 CCCCTCCACAGGTAAGTGATTGG - Intergenic
1054731204 9:68704770-68704792 CCCCTTCACGAGGAAGGGACAGG - Intergenic
1060736415 9:126069135-126069157 CCCCTCCACACCCAAGAGGCAGG - Intergenic
1060881700 9:127122381-127122403 CCCCTCCAGAGGCCATGGACAGG - Exonic
1061299718 9:129697625-129697647 CCCCTCCGCACGCGCGGGTCTGG - Intronic
1061922803 9:133791351-133791373 CCCCTCCAGGGGCAATGGACAGG - Intronic
1062039552 9:134397816-134397838 GCCCTCCCCACACAAGGGAGCGG - Intronic
1062293838 9:135813077-135813099 ACCCTCCACACGCCTGGGAATGG + Intronic
1185563743 X:1080389-1080411 ACCATCCACATGGAAGGGACTGG + Intergenic
1186401940 X:9268326-9268348 CACTTCCACATGCAGGGGACAGG + Intergenic