ID: 1132097073

View in Genome Browser
Species Human (GRCh38)
Location 15:98994670-98994692
Sequence GACAGTGTGAAATGCAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 310}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132097073_1132097076 8 Left 1132097073 15:98994670-98994692 CCCTCCTTGCATTTCACACTGTC 0: 1
1: 0
2: 1
3: 35
4: 310
Right 1132097076 15:98994701-98994723 ATCATTTTCCTTCCTTTTGAAGG 0: 1
1: 0
2: 10
3: 111
4: 1307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132097073 Original CRISPR GACAGTGTGAAATGCAAGGA GGG (reversed) Intronic
900438432 1:2642105-2642127 GGCAGTGGGAATTGCAGGGAGGG - Intronic
900828685 1:4948495-4948517 GAGATTTTGAAATGAAAGGAAGG - Intergenic
901719499 1:11185112-11185134 GACAGTGTGACATGCTAGGATGG - Intronic
903971845 1:27124014-27124036 GACACTGGGAAAGGAAAGGAGGG - Intronic
905458015 1:38101787-38101809 GACAGTGTGATATGGCAGAAAGG - Intergenic
905804158 1:40863816-40863838 GAGAGTGTCAAATGCGTGGAGGG - Intergenic
907865595 1:58396562-58396584 GACACAGAGATATGCAAGGAGGG + Intronic
907879230 1:58529561-58529583 AACAGAGTGAAAAGCAAGGAAGG + Intronic
908181236 1:61608453-61608475 GGAAGAGTGAAATGCAAGGATGG - Intergenic
908670370 1:66540413-66540435 GAAAGGCAGAAATGCAAGGAAGG - Intronic
909110013 1:71463237-71463259 GAGACTGGGAAATGCAGGGAAGG + Intronic
909712073 1:78663033-78663055 AAAAGAGGGAAATGCAAGGAGGG - Intronic
910712105 1:90192904-90192926 AACAGTTTGCAATGCAAGGCAGG - Intergenic
914951247 1:152116469-152116491 TATAGTCTGAAATGTAAGGAAGG - Intergenic
915650709 1:157308390-157308412 GAAAGTGTGGAAGGGAAGGAGGG - Intergenic
915824748 1:159063571-159063593 GACACAATGAAATGTAAGGAAGG - Exonic
916852301 1:168715830-168715852 GATGGTGGGAAATGCAAAGAAGG - Intronic
919785667 1:201256695-201256717 GACAGAGTGAGATGGAATGATGG + Intergenic
920419259 1:205819628-205819650 AACAGAGTGAAATGGCAGGAAGG + Intergenic
921920110 1:220658970-220658992 TATAGGATGAAATGCAAGGAGGG - Intronic
921936637 1:220802141-220802163 GACAGTGTGATCACCAAGGAGGG - Intronic
923115645 1:230935242-230935264 GACAGTGTGAGGTGCAGGGAAGG + Intronic
923234526 1:232019831-232019853 GACAATCTGGAATGCAATGATGG - Intronic
924313386 1:242770595-242770617 GACAGAATGAAATCCCAGGAGGG + Intergenic
924519094 1:244790591-244790613 GACAGTGTGGAATGGACAGAAGG + Intergenic
1064471083 10:15636718-15636740 GACAGTGGAAATTGAAAGGAAGG - Intronic
1064870318 10:19929827-19929849 GACAGTGTGAAATGAATGTGGGG - Intronic
1068388377 10:56360704-56360726 GCCAGGGAGATATGCAAGGAAGG + Intronic
1069456664 10:68559595-68559617 AATGGTGTGAAATGCAATGAGGG + Intergenic
1069833735 10:71296065-71296087 GACAGTGAGAGATCCAGGGAGGG - Intronic
1069909916 10:71752665-71752687 GACAGTGAGACATGCAAAGGAGG - Intronic
1071554792 10:86593702-86593724 GACAGAGTGAGATGAAGGGAAGG + Intergenic
1072526011 10:96272335-96272357 GAAAGAGGCAAATGCAAGGAGGG - Intergenic
1072985017 10:100131759-100131781 GTCAGTGTGAAGTGCGTGGATGG + Intergenic
1074551387 10:114445618-114445640 GTCAACGTGCAATGCAAGGAAGG + Intronic
1074566515 10:114583950-114583972 GACACTGGGGAATGCAAGGGTGG + Intronic
1074589545 10:114799728-114799750 GACTGTGGGAAAGGCAAGAATGG - Intergenic
1074789138 10:116868727-116868749 GACAGTGTCATATGGAAGGATGG - Intronic
1075955666 10:126520751-126520773 GACACTGAGAAGGGCAAGGAAGG - Intronic
1076947408 10:133660634-133660656 AACAGTGGGAAATGGAAGAATGG - Intergenic
1079377065 11:19902914-19902936 CACAATGTGAAGTGCAAGCATGG + Intronic
1080375839 11:31709985-31710007 GACTGTGATAAGTGCAAGGAAGG - Intronic
1085299553 11:75450226-75450248 GACAGCGAGAAATGGAAGGGAGG + Intronic
1086560875 11:88167630-88167652 GAGAGTGGGCAATGAAAGGAAGG + Intronic
1089427009 11:118386164-118386186 AGCATTGTGAAATGCAAAGAAGG - Intronic
1089812181 11:121141285-121141307 GACAGTGTGAAATGAAGTGCTGG + Intronic
1090261920 11:125327446-125327468 GTCAGAGAGAAATGGAAGGATGG - Intronic
1090486568 11:127117796-127117818 AACAGTGGGAAAAGCAGGGAGGG - Intergenic
1091480747 12:827831-827853 AACAGTGTGTAATGAAAAGATGG - Intronic
1091603210 12:1930203-1930225 GAGGCTGTGAAATGGAAGGATGG - Intergenic
1092092587 12:5815206-5815228 GAGAGTGTAAAATGCATGGCAGG - Intronic
1093850039 12:24025227-24025249 GAGAGTGAGAAATGGAAAGATGG + Intergenic
1095840598 12:46687548-46687570 GAGAGAGGGAAATGCAAGAATGG + Intergenic
1095897194 12:47291633-47291655 GAAATTTTGAAAGGCAAGGATGG - Intergenic
1096608971 12:52788687-52788709 GGCAGTGTGACATGCCTGGAAGG + Intergenic
1098302385 12:69067405-69067427 GTGAGTGTAAAATGCAAGGACGG + Intergenic
1098898727 12:76090857-76090879 GAAAGAATGAAATGAAAGGAAGG + Intergenic
1100167992 12:91940088-91940110 GACACTGAGAAATACAAGGTGGG - Intergenic
1101009502 12:100434916-100434938 GACAGAGGGAACTGCAAGGTGGG - Intergenic
1101254388 12:102963436-102963458 GATAGTGGTAAATGCCAGGAAGG - Intergenic
1101313252 12:103603582-103603604 GACAGTGTGGTATTCATGGAAGG - Intronic
1101896678 12:108762232-108762254 GACAGAGTGAGATGGAAGGAGGG + Intergenic
1102363673 12:112312095-112312117 GAAAGTGGGAAATGAAAGGGAGG + Intronic
1102802950 12:115752591-115752613 CTCAGTGTGAGAGGCAAGGATGG - Intergenic
1102906069 12:116676103-116676125 GACCGAGTGAAATTGAAGGAGGG - Intergenic
1104938369 12:132379625-132379647 AACAGAGTGAAATGGAACGAAGG - Intergenic
1105330870 13:19414023-19414045 GACAGTGTAGACAGCAAGGAGGG + Intergenic
1108982421 13:56534243-56534265 GACAGAGAGAAAAGGAAGGAAGG + Intergenic
1110622828 13:77618197-77618219 GATAGAATGAAATGGAAGGAAGG - Intronic
1110764583 13:79268180-79268202 GTCAGTGAGGAATTCAAGGATGG + Intergenic
1111884618 13:94004687-94004709 CACAGTGTAAAATGCCAGGAAGG + Intronic
1112631710 13:101168669-101168691 GTCAGTGTGAAATGCACTGGAGG - Intronic
1114523602 14:23353730-23353752 GACAGTGTGAGATGAGAGGAGGG - Intergenic
1116798435 14:49416273-49416295 GGAGGTGAGAAATGCAAGGAAGG + Intergenic
1119110235 14:71965776-71965798 GTCTGTGTGAAAGGTAAGGAGGG + Intronic
1120398077 14:83993487-83993509 AACAGTGTGAAAAGCAAAGAAGG + Intergenic
1120606214 14:86582070-86582092 GAAAGTAGGAAATGCAAGTATGG + Intergenic
1120793558 14:88607640-88607662 TGCAGGGTGAAATGCAGGGATGG - Intronic
1121452924 14:94020847-94020869 AACTGTGAGAAATGCTAGGATGG + Intergenic
1122046070 14:99024937-99024959 GAGAATGTGCAATGCATGGAGGG + Intergenic
1202921465 14_KI270723v1_random:33185-33207 AACAGTGGGAAATGGAAGAACGG - Intergenic
1202923448 14_KI270724v1_random:4395-4417 AACAGTGGGAAATGGAAGAAAGG + Intergenic
1123972699 15:25523404-25523426 GACTGTGGGAAATCCAAGGTGGG + Intergenic
1126315358 15:47363904-47363926 GAGAGAGAGAAATGCAAGCAGGG + Intronic
1126435910 15:48637330-48637352 GATGTTGTGAAAGGCAAGGACGG - Intronic
1126575799 15:50195062-50195084 AACAGGGTGAAATGGAAGTAGGG + Intronic
1127484275 15:59404928-59404950 GACAGAGTGAGATGGAAGCAGGG - Intronic
1127623537 15:60757839-60757861 GAGAGTGTGAAAAGGAAGGAGGG - Intronic
1127831395 15:62754537-62754559 AACAGTGTGTACTGCAAGGAAGG + Intronic
1128519666 15:68366999-68367021 CACAGTGGAAAATGCAAGGCTGG - Intronic
1128787675 15:70410300-70410322 GACAGAGTGACTTGCAAGGAAGG + Intergenic
1130442592 15:83970206-83970228 GAAAGAGTGAGATGGAAGGAGGG + Intronic
1130552633 15:84900857-84900879 GGAAGGGTGAAAGGCAAGGAAGG + Intronic
1132097073 15:98994670-98994692 GACAGTGTGAAATGCAAGGAGGG - Intronic
1134237929 16:12482308-12482330 GACTCTGTGAAAGGAAAGGAAGG - Intronic
1134830990 16:17322757-17322779 TAAAGTGTGAAATGCTATGAAGG - Intronic
1134832937 16:17338102-17338124 GAAAGTGGGAAAGGAAAGGAGGG - Intronic
1135779312 16:25285835-25285857 GACAGTATCAAATGCCAGCAAGG - Intergenic
1141599402 16:85116085-85116107 GACAGTGTCAGATGCCAGCACGG - Intergenic
1142169492 16:88614002-88614024 GTGGGGGTGAAATGCAAGGAGGG + Intronic
1144057079 17:11552923-11552945 GACAGTGGGAAAAGAAAGGACGG + Intronic
1144173605 17:12683378-12683400 GACAGTGACAAATGAAAGAAAGG - Intronic
1144472467 17:15556938-15556960 GACAGTGTCAGAAGCAAGTAGGG - Intronic
1144924009 17:18787750-18787772 GACAGTGTCAGAAGCAAGTAGGG + Intronic
1146050629 17:29549820-29549842 GATATTGTGAAATGCAAAGAAGG - Exonic
1146393081 17:32440768-32440790 GACTGTGTTAAATGCTAGGAAGG + Intergenic
1146544446 17:33725994-33726016 GACTGTGTGGCATGCAAAGATGG + Intronic
1147157345 17:38550944-38550966 GACAGTGGGAAATGCCGGGATGG + Intronic
1147740595 17:42669221-42669243 GACAGTGAGAAATGCTACAAAGG - Intronic
1148642975 17:49202009-49202031 GACTGTGTGGATTGAAAGGAGGG - Intergenic
1149570158 17:57666622-57666644 AACACTGTGAAATCCAAGGCTGG - Intronic
1150630968 17:66880267-66880289 GACAGTGTGGACTCCCAGGAGGG + Intronic
1150637185 17:66921868-66921890 GTCATGGTGAAAGGCAAGGAGGG - Intergenic
1150957074 17:69870833-69870855 GACAGAGAGAAAGGCAAGGCAGG - Intergenic
1152560371 17:81075659-81075681 GAAAGGGTTAAAGGCAAGGAGGG - Intronic
1203171306 17_GL000205v2_random:149633-149655 AACAGTGGGAAATGGAAGAATGG - Intergenic
1153377080 18:4392740-4392762 GACAGTTTGAAATGTGAGGCTGG - Intronic
1155243405 18:23884841-23884863 CACAGTGTGAAAGGTAAGGTGGG + Exonic
1156074649 18:33259314-33259336 TACAGTAAGAAATGCAAGAAAGG - Intronic
1156242232 18:35265811-35265833 CACAGTGATAAATCCAAGGACGG + Intronic
1157158431 18:45289785-45289807 GCCAATGTGTCATGCAAGGAAGG + Intronic
1157327785 18:46681387-46681409 GACAGTGGGAGATGAGAGGAGGG - Intronic
1157673448 18:49550048-49550070 GACAGTGTGAACAGGAAGGGAGG + Intergenic
1159972004 18:74666432-74666454 GGCAGTGTGATAAGCAAGGGAGG - Intronic
1161510708 19:4669726-4669748 GACCTTGTGCAATGGAAGGAAGG + Intronic
1164212936 19:23116424-23116446 GACAGAGTGAGATGAAAGGAAGG - Intronic
1165247548 19:34505858-34505880 GACAGTGTGGGATGGGAGGAGGG - Exonic
1165420570 19:35720137-35720159 GGCAGCTGGAAATGCAAGGAGGG + Exonic
1166292449 19:41871791-41871813 GAAAGTGAGAAACGAAAGGATGG + Exonic
926867931 2:17380051-17380073 GACAGTGGAAACTGCAAGAAAGG - Intergenic
927197326 2:20557663-20557685 GACACAGAGAAAGGCAAGGAGGG + Intergenic
928250761 2:29676527-29676549 GACAGTGTGATATTAAAGAAAGG - Intronic
929139525 2:38654815-38654837 GAGAGAGGGAAAGGCAAGGAGGG - Intergenic
929720247 2:44361128-44361150 GACAGTATGCAAGGCTAGGATGG + Intronic
930536094 2:52648138-52648160 GACAGTGTGAAAGGAAAGTGTGG - Intergenic
931132167 2:59348890-59348912 GACAGTGTGAGATTCATGGGTGG - Intergenic
931305297 2:61022513-61022535 TTCATTGAGAAATGCAAGGATGG - Intronic
933450637 2:82445746-82445768 TCCAGTATGAAATGCAGGGAGGG + Intergenic
935201873 2:100863820-100863842 TACAAAGTGGAATGCAAGGAGGG - Intronic
939543922 2:143529085-143529107 GACAGAGGGAAATTCAAGAAGGG - Intronic
940118218 2:150233963-150233985 GAAAGTGTGAAAGTGAAGGATGG + Intergenic
940961557 2:159792332-159792354 GACAGTGTGACAATCAAGGCTGG - Intronic
942231618 2:173865999-173866021 CACAGTATGAAAAGCAATGAAGG - Intergenic
942497860 2:176558597-176558619 GAGAGTCTGAAAGGCAAAGATGG + Intergenic
943793990 2:191968709-191968731 TACACTGTGAGATGCCAGGAGGG + Intronic
944348805 2:198702668-198702690 GACAGTGTAAAATATAGGGAGGG + Intergenic
944753860 2:202739479-202739501 GACAGAGTGAAACCCTAGGAAGG - Intronic
944937293 2:204582637-204582659 GAGTGGGAGAAATGCAAGGAGGG - Intronic
945059442 2:205896016-205896038 TCCAGTGTGAAATGCTGGGAAGG - Intergenic
945204551 2:207318329-207318351 GACAGAGTGAAATGAAATGTAGG + Intergenic
945703898 2:213204940-213204962 GACATTGAGAAATGCAAGAGAGG - Intergenic
947088598 2:226484359-226484381 CAAAGTCTGAAATGGAAGGAAGG - Intergenic
1169411254 20:5372333-5372355 GACAGTGTGAAATGGAGACAAGG + Intergenic
1170918981 20:20657651-20657673 GGCACTGTGAACTGCATGGAAGG - Intronic
1171823953 20:29878041-29878063 GAGAGAGTGAGATGGAAGGATGG - Intergenic
1171896124 20:30812296-30812318 GAGAGAGTGAGATGGAAGGATGG + Intergenic
1172931876 20:38592139-38592161 GAACCTGTGAAAGGCAAGGAAGG - Intergenic
1173480959 20:43399040-43399062 GACAGAGTGAGAGGCATGGAAGG - Intergenic
1174423813 20:50418044-50418066 GACTGTGTGAAATGCAACTGTGG + Intergenic
1175541063 20:59747924-59747946 AACAGTGTAGAATCCAAGGAGGG + Intronic
1176327287 21:5511461-5511483 AACAGTGGGAAATGGAAGAATGG - Intergenic
1176330421 21:5544770-5544792 AACAGTGGGAAATGGAAGAATGG + Intergenic
1176397336 21:6276181-6276203 AACAGTGGGAAATGGAAGAATGG - Intergenic
1176400470 21:6309490-6309512 AACAGTGGGAAATGGAAGAATGG + Intergenic
1176436687 21:6679614-6679636 AACAGTGGGAAATGGAAGAATGG - Intergenic
1176439821 21:6712923-6712945 AACAGTGGGAAATGGAAGAATGG + Intergenic
1176460949 21:7006684-7006706 AACAGTGGGAAATGGAAGAATGG - Intergenic
1176464083 21:7039992-7040014 AACAGTGGGAAATGGAAGAATGG + Intergenic
1176484510 21:7388462-7388484 AACAGTGGGAAATGGAAGAATGG - Intergenic
1176487644 21:7421771-7421793 AACAGTGGGAAATGGAAGAATGG + Intergenic
1178745090 21:35241693-35241715 GACAGAGGCAAATGGAAGGATGG + Intronic
1179318684 21:40269671-40269693 GACACTGGGCAAGGCAAGGAAGG - Intronic
1182062345 22:27407264-27407286 GACAGGGAGAGATGCGAGGAGGG + Intergenic
1182564981 22:31191455-31191477 GACAGTGGAAAATGCAGGCATGG - Intronic
1182654817 22:31881462-31881484 GACAGTTAGAAATGCAATGAAGG - Intronic
1183141779 22:35948578-35948600 GACAGGCTGAAATGGGAGGATGG + Intronic
1183445041 22:37848034-37848056 CTCAGTGGGAAAAGCAAGGAGGG + Intronic
949662447 3:6294614-6294636 GACAGTGGGAAATAAAAAGAAGG + Intergenic
950448560 3:13052693-13052715 GACAACGTGAAATGCCAGGAGGG - Intronic
951361861 3:21734919-21734941 GACAGTGAGGAATGGAATGAGGG + Intronic
951528318 3:23674904-23674926 GAGATTGGGAAATACAAGGATGG - Intergenic
951734653 3:25851016-25851038 GACAGTGATAAGTGCTAGGAAGG + Intergenic
952827913 3:37539332-37539354 GACAGTGAGACAGGAAAGGAAGG + Intronic
953451736 3:43012009-43012031 GACAGTGTGAAGCCAAAGGAAGG + Intronic
953451975 3:43013336-43013358 GGCAGTGTGAAGTCAAAGGAAGG + Intronic
955787898 3:62559144-62559166 AAGTGTGTCAAATGCAAGGAAGG - Intronic
956553582 3:70491207-70491229 GACATTATGAAATGGAAAGAGGG - Intergenic
957826993 3:85460455-85460477 TACATTTTGAAATGCAAGGAAGG - Intronic
958853575 3:99357836-99357858 GAAGTTGTGAAATGGAAGGAAGG + Intergenic
959999804 3:112718917-112718939 GACACTGTGCTATGCAAGGCAGG - Intergenic
960013210 3:112856156-112856178 GACAGTGTGCATTGCCAAGAAGG - Intergenic
960627678 3:119697623-119697645 GACAGTGTGGAGGGCAAGGGGGG + Intergenic
961055040 3:123780609-123780631 AACAGTGTGATCTGGAAGGAGGG - Intronic
961129038 3:124448292-124448314 GACAGGGTGGATTGGAAGGAAGG - Intronic
961404431 3:126668274-126668296 CACATTGTGAGATGCAAGCAGGG + Intergenic
961472023 3:127121367-127121389 GACAGTCTCAAAAGCAAGTATGG - Intergenic
964004665 3:151812835-151812857 AAGAGTGTGAAATGCCAGGATGG - Intergenic
965753641 3:172002842-172002864 GACTGAGTAAAAAGCAAGGATGG + Intergenic
967081991 3:186058338-186058360 GACAGGCTGAACTACAAGGAGGG - Intronic
967570901 3:191027222-191027244 GACAGAGTGGCTTGCAAGGAAGG + Intergenic
968447964 4:661972-661994 GCCAGTGGGAAACGCAGGGATGG + Intronic
969677347 4:8621404-8621426 GACAGAATGAAGTGCAGGGAAGG - Intergenic
969678302 4:8627042-8627064 GACAGAATGAAGTGCAGGGAAGG - Intergenic
969679258 4:8632680-8632702 GACAGAATGAAGTGCAGGGAAGG - Intergenic
969991117 4:11263606-11263628 GACAGTTTGAAATTCGAAGAAGG - Intergenic
972595456 4:40526032-40526054 GACAAACTGAAATGCAAGCATGG + Intronic
973369426 4:49233978-49234000 GACAGTGTGGAATGCATCTATGG - Intergenic
973391610 4:49561438-49561460 GACAGTGTGGAATGCATCTATGG + Intergenic
975557641 4:75680612-75680634 GAGAGTGGGAAATGGAAGGATGG - Intronic
975970111 4:80023727-80023749 GACAGGGTGGAAGGCAAGAAAGG + Intronic
976707725 4:88036442-88036464 CACAGTGTTAAATGCAAAGCAGG - Intronic
977867550 4:102047814-102047836 CACAGAGAGCAATGCAAGGAAGG + Intronic
978564881 4:110071124-110071146 TAAACTGTGAACTGCAAGGAAGG + Intronic
978859743 4:113434151-113434173 GACATTATGAAATGCAATGATGG - Intergenic
979218482 4:118193931-118193953 GACACTGTGTACTTCAAGGAAGG - Intronic
979318702 4:119298636-119298658 CAAAGTGTAAAATGAAAGGAAGG + Exonic
980005635 4:127539076-127539098 GCCAGTGTGCATTACAAGGAAGG - Intergenic
982761909 4:159294714-159294736 GACAGAGTGAGAGGAAAGGATGG - Intronic
984668564 4:182455504-182455526 AACTCTGTGAGATGCAAGGAAGG - Intronic
985139855 4:186828815-186828837 GATGGTGTGAAATGGGAGGAGGG - Intergenic
985545977 5:509433-509455 GAGAGAGTGAGATGGAAGGAAGG + Intronic
985786664 5:1899120-1899142 GACAGTGTGCCTTGCAAGGCTGG + Intergenic
986037732 5:3957025-3957047 GACAAAGAGAAATGCATGGACGG - Intergenic
986055733 5:4135316-4135338 GAGGGTGGGAAATGGAAGGAGGG + Intergenic
986679707 5:10221771-10221793 GACAGTGTGCAGTGCAGGCATGG - Intergenic
986722668 5:10571131-10571153 TACAGTGTGAAATGGAGAGAGGG + Intronic
990903411 5:60778127-60778149 GCCATTGTTAAAAGCAAGGAGGG - Intronic
992489570 5:77229040-77229062 GACAGAGGGAAAGGAAAGGATGG + Intronic
992569076 5:78034541-78034563 GAAACTGTGAAATGTAATGATGG + Intronic
993945936 5:94116841-94116863 GGCAGTGTGGAAGGCAAGTATGG + Intergenic
994737208 5:103569795-103569817 GAGAGTATGAATTGAAAGGAGGG - Intergenic
994802901 5:104401500-104401522 TACAATATGAAAGGCAAGGAAGG - Intergenic
995162645 5:108999179-108999201 AACAGTATAAAATTCAAGGAAGG - Intronic
996565539 5:124876554-124876576 GAAAGCGTGTAATGCAAGGAGGG - Intergenic
997100934 5:130968809-130968831 GACAGGGTGAAAGGGAAGGGGGG - Intergenic
997377255 5:133406072-133406094 GATGGTGTTAAATGCGAGGAAGG + Intronic
997580823 5:135015797-135015819 AACAGTGGGAAATGCTAAGAGGG + Intergenic
998653867 5:144152840-144152862 GACAGTGTGAAAGTCAAGACTGG - Intergenic
999573475 5:152946987-152947009 GGCAGTGTCAGATGAAAGGAAGG - Intergenic
1000150772 5:158498472-158498494 GAAAATGTGAAAAGGAAGGAGGG - Intergenic
1000285508 5:159823061-159823083 GATACTGTTAAATGCTAGGAAGG + Intergenic
1000962330 5:167614627-167614649 GACTGTGTGAAATAAAAGGAAGG + Intronic
1002486543 5:179541717-179541739 GACAGTATGAAAAGAAAGGTGGG - Intergenic
1003537032 6:6984476-6984498 GATAGTGTGACAAGCAATGAGGG + Intergenic
1003796050 6:9606113-9606135 CACAGTGGGAAACACAAGGATGG + Intronic
1004270840 6:14193656-14193678 GACAGTGTGGAATGCCTGGGAGG + Intergenic
1004289236 6:14351300-14351322 GACACTGGGAGAGGCAAGGAAGG - Intergenic
1006287528 6:33108104-33108126 GACAGTGTGGAAAGCCAGGCTGG - Intergenic
1006644540 6:35506832-35506854 GACAGTGTGCAAAGGAGGGAAGG - Intronic
1007147082 6:39646830-39646852 AACTGTGTGAAAGGCAAGTATGG - Intronic
1007599485 6:43072908-43072930 GACAGTGTGAAATTCGAGGGAGG + Exonic
1007914989 6:45552947-45552969 AACAGTATGAAAGGCAAGGGAGG + Intronic
1008373051 6:50758397-50758419 GACATTGGGAAATGGAAGGAAGG - Intronic
1008532435 6:52476055-52476077 GACAGTGTGCAGTGAATGGAGGG + Intronic
1008593043 6:53012757-53012779 CACAATGTGAGATGCAAGGGTGG - Intronic
1008629929 6:53353883-53353905 CAGAGTGTGAAAGGCAGGGAGGG - Intergenic
1008678149 6:53843704-53843726 GATAGTGTCAAATGCAAGCTTGG - Intronic
1009781048 6:68271304-68271326 GAAAGACTGAAATGCAAGAAGGG - Intergenic
1010906843 6:81501527-81501549 GACAGTGTGAAAGGGAAATATGG + Intronic
1011743928 6:90390796-90390818 AACAATGTGCTATGCAAGGATGG - Intergenic
1011967927 6:93183053-93183075 GAAAATTTGAAATGCAAGGTTGG - Intergenic
1012424261 6:99096708-99096730 GAGATTGAGAAATGCAAGGCTGG + Intergenic
1013546232 6:111160669-111160691 GACAATTTGAAGTGTAAGGATGG + Intronic
1014048561 6:116924618-116924640 GACAGTGTGAAATGTAAAAAGGG - Intronic
1014768764 6:125437405-125437427 GTGAGTGAGAAATGCCAGGAGGG + Intergenic
1015772523 6:136783719-136783741 GACAGTGTGCTGTGCAATGATGG - Intronic
1016628054 6:146195807-146195829 GATAGTGGTAAATGAAAGGATGG + Intronic
1016696003 6:146997311-146997333 GACAGGCTGACATGGAAGGAAGG + Intergenic
1018217406 6:161542503-161542525 GACAGCTTGAAGTGCAAAGATGG - Intronic
1018433253 6:163740134-163740156 CACACTGTGAAATGCAGGGCTGG + Intergenic
1019090952 6:169533233-169533255 GACAGCGTGGCATGGAAGGAGGG + Intronic
1021013452 7:15501613-15501635 TACAGTGACAAATGCAGGGATGG + Intronic
1023159474 7:37283608-37283630 CACTGTCTGAAATGCAAAGATGG - Intronic
1023261874 7:38366924-38366946 GAAAGAGAGAAAAGCAAGGAAGG + Intergenic
1023331259 7:39119470-39119492 GAGAGAGTCAAATGGAAGGATGG + Intronic
1023351163 7:39321339-39321361 GACAGAGGGAAATAGAAGGAGGG + Intronic
1023457262 7:40354106-40354128 CACAGTGTGAAAAGAAGGGAGGG - Intronic
1025028607 7:55537737-55537759 GACAGTGTGAAAAGCAGGTCCGG + Intronic
1025104489 7:56159995-56160017 GACAGTTGGAAATGCAAGCTTGG + Intergenic
1025774853 7:64551702-64551724 GACACTGTGAAATGCTAAAATGG + Intronic
1027132232 7:75599242-75599264 GACAGTCTGAAAAACAAGAAGGG + Exonic
1027960084 7:84934562-84934584 GAAAGAGTGAAAGGGAAGGAGGG + Intergenic
1028025457 7:85832021-85832043 GACTGTGTGAAAAGAAAGGGAGG + Intergenic
1028224895 7:88238819-88238841 GACAGTGACAAGTGCAAGGATGG + Intergenic
1028989245 7:97032520-97032542 GAAAGTGACAATTGCAAGGATGG - Intergenic
1029020038 7:97355719-97355741 CACAGTCTAAAATGAAAGGAGGG - Intergenic
1030783187 7:113627016-113627038 GTCACTTTGAAATGGAAGGAGGG - Intergenic
1031224455 7:119017623-119017645 GACAGTGTGGCGTGCAGGGATGG + Intergenic
1032950002 7:136897025-136897047 GTCAGTGTGGTAGGCAAGGAGGG + Intronic
1034514048 7:151559907-151559929 GAGTGTGTGAAATGAGAGGAAGG + Intronic
1034653468 7:152711016-152711038 GATACTGTAAAATCCAAGGATGG - Intergenic
1035727058 8:1831229-1831251 GACAGTGTGACATCCGTGGAGGG + Intronic
1035727071 8:1831293-1831315 GACAGTGTGACATCCATGGAGGG + Intronic
1035727084 8:1831357-1831379 GACAGTGTGACATCCATGGAGGG + Intronic
1035727103 8:1831467-1831489 GACAGTGTGACATCCGTGGAGGG + Intronic
1035727112 8:1831511-1831533 GACAGTGTGACATCCGTGGAGGG + Intronic
1035727121 8:1831555-1831577 GACAGTGTGACATCCGTGGAGGG + Intronic
1037380714 8:18282822-18282844 TCCAGTGTGAAATGCAGGAATGG + Intergenic
1037789284 8:21922009-21922031 GACAGTCTGCAATGCATTGAGGG + Intronic
1038227600 8:25671044-25671066 GACAGTGTGGTAACCAAGGAAGG - Intergenic
1039637901 8:39185708-39185730 GACAGTATGAAATAGAAGGCTGG - Intronic
1042304980 8:67321980-67322002 TGGAGTGTGGAATGCAAGGAAGG - Intronic
1042655155 8:71087726-71087748 GGCAATGTTAAATACAAGGACGG + Intergenic
1044659742 8:94583215-94583237 GACACTAAGAAATGCAAGGCTGG - Intergenic
1045463967 8:102452132-102452154 GACCCTGTCAAATGGAAGGAAGG - Intergenic
1045658806 8:104414565-104414587 GGCAGTGAGTAATTCAAGGAAGG - Intronic
1046587287 8:116163045-116163067 GATTGTGAGAAATGCAATGAAGG - Intergenic
1046917055 8:119689078-119689100 GACAGTATGAAGTGAGAGGAGGG + Intergenic
1047212801 8:122853646-122853668 GAGAGTATGAATTCCAAGGAGGG - Intronic
1047354168 8:124104405-124104427 CAAGGTGTGAAATGCAGGGAAGG + Intronic
1047966893 8:130051543-130051565 GGCAGTGGGAATTGCAAGGATGG + Intergenic
1049694017 8:143974928-143974950 GACCGTGTTAAAATCAAGGATGG + Intronic
1050615568 9:7398439-7398461 GACAGTGTGAATTATGAGGATGG + Intergenic
1051185127 9:14452398-14452420 GACAGAGGGAGATGGAAGGAAGG + Intergenic
1052007983 9:23373577-23373599 AATAGTGTGAAATTCAAGCAAGG + Intergenic
1053603284 9:39631869-39631891 GGCAGTGTGTACTTCAAGGAAGG + Intergenic
1053860916 9:42385590-42385612 GGCAGTGTGTACTTCAAGGAAGG + Intergenic
1054250254 9:62710556-62710578 GGCAGTGTGTACTTCAAGGAAGG - Intergenic
1054337097 9:63817138-63817160 GACAGAGTGAGATGGAAGGATGG - Intergenic
1054564362 9:66745084-66745106 GGCAGTGTGTACTTCAAGGAAGG - Intergenic
1055955066 9:81765750-81765772 GACAGTGATAATTGCAATGAAGG - Intergenic
1056307145 9:85301250-85301272 GAGAGGGTGAGATGGAAGGATGG + Intergenic
1056390092 9:86132974-86132996 CACAGTGTAAAATAAAAGGATGG - Intergenic
1056734109 9:89190792-89190814 GCCAGTGTCTAATGCAGGGAGGG - Intergenic
1057426241 9:94952092-94952114 GACAGTGTGAGAGGCAGGAAGGG - Intronic
1057786681 9:98093279-98093301 GACAGAGGGAAAAGCAAGGGTGG - Intronic
1058429043 9:104901620-104901642 GGCAGGGAGAAAGGCAAGGAAGG + Intronic
1058876237 9:109247305-109247327 GACACTGTAAAATCCAAGAAGGG + Intronic
1059613567 9:115924675-115924697 GAGAGGGAGAAATGGAAGGAGGG + Intergenic
1059844157 9:118253090-118253112 GACAGTATGCAATATAAGGATGG - Intergenic
1060003587 9:119980484-119980506 GACAGTGCAAAAATCAAGGAAGG + Intergenic
1203431674 Un_GL000195v1:95556-95578 AACAGTGGGAAATGGAAGAATGG - Intergenic
1203434826 Un_GL000195v1:129045-129067 AACAGTGGGAAATGGAAGAATGG + Intergenic
1203377034 Un_KI270442v1:384559-384581 GACAGAGTGAGATGGAAGGATGG - Intergenic
1186373869 X:8977088-8977110 GACACTGGGAAATACAAGAAGGG - Intergenic
1186397909 X:9228664-9228686 TACAGTGTGGGAAGCAAGGATGG - Intergenic
1187178534 X:16919486-16919508 CAGAGTCTGACATGCAAGGAGGG - Intergenic
1190635064 X:52425220-52425242 GTCAGAGTGAAATCCAAGAATGG + Intergenic
1193258647 X:79379753-79379775 CACAGAGAGAAATGAAAGGAGGG + Intergenic
1193906455 X:87251481-87251503 GAGAGTGGGAAATGAAAGAAAGG - Intergenic
1194027641 X:88773322-88773344 GACACTATCAAATGGAAGGAAGG + Intergenic
1194946852 X:100079141-100079163 GAAAATGTGAACTACAAGGAGGG + Intergenic
1195324144 X:103744324-103744346 GACAGTGGGAGAGGCAGGGAAGG + Intergenic
1195331584 X:103807517-103807539 GACAGTGGGAAAGGCAGGGAGGG - Intergenic
1196214728 X:113037183-113037205 GACAGCGTCAAATGCTAGCAAGG - Intergenic
1198726157 X:139679336-139679358 GAAGATGTGAAATGTAAGGAAGG + Intronic
1201107581 Y:10774682-10774704 GGAAGGGTGAAATGCAATGAGGG - Intergenic