ID: 1132099251

View in Genome Browser
Species Human (GRCh38)
Location 15:99011738-99011760
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132099251_1132099255 -8 Left 1132099251 15:99011738-99011760 CCATCCACAATGCCCTTCAAATA No data
Right 1132099255 15:99011753-99011775 TTCAAATATCAGAAATCTCTAGG No data
1132099251_1132099258 30 Left 1132099251 15:99011738-99011760 CCATCCACAATGCCCTTCAAATA No data
Right 1132099258 15:99011791-99011813 AAATGTATGAGATCCTTTTGTGG No data
1132099251_1132099256 3 Left 1132099251 15:99011738-99011760 CCATCCACAATGCCCTTCAAATA No data
Right 1132099256 15:99011764-99011786 GAAATCTCTAGGAATAAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132099251 Original CRISPR TATTTGAAGGGCATTGTGGA TGG (reversed) Intergenic
No off target data available for this crispr